Hi Torsten Thanks for that. You are right that the sequences could be nucleotide or protein. The behaviour therefore should probably be that it ignores any non-base sequences and warns that it has done that. I will look at implementing that change.
Regards Tim On 10/29/12 3:29 AM, "Torsten Seemann" <torsten.seem...@monash.edu> wrote: > Tim, > > We commonly use multi-sequence GBK and GFF files. We know Artemis doesn't work > with mult-GBK but it does work with GFF containing multiple source sequences > (typically contigs) in the ##FASTA section. However, we are getting some GFF > files that also have the translated protein sequences of each CDS feature in > the ##FASTA section (much like CDS in GBK have /translation tags), like this: > > ##gff-version 3 > contig1 CDS ID=prot1 > contig2 CDS ID=prot2 > ##FASTA >> >contig1 > ATCTTAGATTCGAGTA >> >contig2 > CTTAGATTCGAGTAAAATTAG >> >prot1 > MVQWHGQ* >> >prot2 > MVHGQQ* > > However, Artemis just treats the proteins as crazy DNA sequences and continues > appending them to the list of source DNA sequences in the annotation. I'm > pretty sure this is a valid GFF file (as /translation may contain wierd AAs > they aren't the original codon etc). > > So how to handle it in Artemis? > Only display ##FASTA entries that have column1 IDs in the feature table? > Should I RTFM ? > > Thanks for any help,
_______________________________________________ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
