[NTG-context] Re: ck hyphenation in old German orthography

2024-03-18 Thread Hraban Ramm
details about hyphenation. \startexceptions[de] He{k-}{k}{ck}en-e{k-}{k}{ck}en-ze{k-}{k}{ck}en \stopexceptions % \registerhyphenationpattern[de][c1k/k=k] % % \setuphyphenation[method=traditional] \mainlanguage[de] \starttext Heckeneckenzecken = \hyphenatedword{Heckeneckenzecken} \stoptext

[NTG-context] Re: ck hyphenation in old German orthography

2024-03-17 Thread Wolfgang Schuster
] He{k-}{k}{ck}en-e{k-}{k}{ck}en-ze{k-}{k}{ck}en \stopexceptions % \registerhyphenationpattern[de][c1k/k=k] % % \setuphyphenation[method=traditional] \mainlanguage[de] \starttext Heckeneckenzecken = \hyphenatedword{Heckeneckenzecken} \stoptext Wolfgang

[NTG-context] issue with custom hyphenator

2023-02-10 Thread Pablo Rodriguez via ntg-context
end ) \stopluacode \definehyphenationfeatures [demo] [alternative=test] \setuphyphenation[method=traditional] \starttext %\righthyphenmin=-1 \sethyphenationfeatures[demo] \hsize\zeropoint coming anaback \stoptext Using current latest (from 2023.02.07

Re: [NTG-context] Bug in verbatim wrapping examples on wiki

2023-02-05 Thread Pablo Rodriguez via ntg-context
d("sha", function(dictionary,word,n) return all end ) \stopluacode \definehyphenationfeatures [sha] [characters=all, alternative=sha, righthyphenchar="FE000] \unexpanded\def\sha#1% {\begingroup\tt \righthyphenmin=-1 \sethyphenationfeatures[sha]

Re: [NTG-context] Bug in verbatim wrapping examples on wiki

2023-02-05 Thread Hans Hagen via ntg-context
end ) \stopluacode \definehyphenationfeatures [sha] [characters=all, alternative=sha] \unexpanded\def\sha#1% {\begingroup \sethyphenationfeatures[sha]% #1% \endgroup} \setuphyphenation[method=traditional] % % \

Re: [NTG-context] Bug in verbatim wrapping examples on wiki

2023-02-05 Thread Pablo Rodriguez via ntg-context
end ) \stopluacode \definehyphenationfeatures [sha] [characters=all, alternative=sha] \unexpanded\def\sha#1% {\begingroup \sethyphenationfeatures[sha]% #1% \endgroup} \setuphyphenation[method=traditional] % % \unexpanded\def\sha

[NTG-context] language identifier for all languages

2022-12-30 Thread Pablo Rodriguez via ntg-context
Hi Hans, as already mentioned in a previous thread (https://mailman.ntg.nl/pipermail/ntg-context/2022/106713.html), I think it might be useful to have an identifier for any language, such as in: \setuphyphenation[method=traditional] \registerhyphenationexception[*][macOS

[NTG-context] \setuplanguage[explicitrighthyphenchar=-1] only works for English

2022-12-15 Thread Pablo Rodriguez via ntg-context
underscore }, } } end utilities.sequencers.appendaction("aftercopyingcharacters", "after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \setuphyphenation[m

Re: [NTG-context] extra hyphen in underscore hyphenation

2022-12-10 Thread Pablo Rodriguez via ntg-context
quot;right", -char.width }, { "down", char.depth }, { "slot", 1, underscore }, } } end utilities.sequencers.appendaction("aftercopyingcharacters", "after","document.addfunnyhyphen") \stopluacode \definehyphenati

Re: [NTG-context] extra hyphen in underscore hyphenation

2022-12-08 Thread Pablo Rodriguez via ntg-context
;after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \setuphyphenation[method=traditional]% \sethyphenationfeatures[underscore]% \setuplanguage [explicitrighthyphenchar=-1] \mainlanguage[

Re: [NTG-context] extra hyphen in underscore hyphenation

2022-12-08 Thread Hans Hagen via ntg-context
derscore }, } } end utilities.sequencers.appendaction("aftercopyingcharacters", "after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \sethyphenationfea

[NTG-context] extra hyphen in underscore hyphenation

2022-12-08 Thread Pablo Rodriguez via ntg-context
ction("aftercopyingcharacters", "after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \sethyphenationfeatures[underscore]% \setuphyphenation[method=traditional]% \starttext \startTEXpage[of

Re: [NTG-context] Fwd: Hyphenation in multi-language projects

2022-10-24 Thread Pablo Rodriguez via ntg-context
On 10/24/22 17:09, Hans Hagen via ntg-context wrote: >> [...] >> Hans, is there any news regarding Pablos wish? > no, because I'm in a different tex mode ... Steffen, meanwhile, a way of crappy cheating... \setuphyphenation[method=traditional] \doloopoverlist{en,nl,de

Re: [NTG-context] Fwd: Hyphenation in multi-language projects

2022-10-24 Thread Hans Hagen via ntg-context
ionexception seems to have issues with ligatures:  \setuphyphenation[method=traditional]  \registerhyphenationexception[steff-en macOS]  \registerhyphenationexception[it][steff-en macOS]  \starttext  \startTEXpage[offset=1em]  \currentlanguage:  \hyphenatedword{steffen macOS}  \startlanguage[it]  \

[NTG-context] Fwd: Hyphenation in multi-language projects

2022-10-24 Thread Steffen Wolfrum via ntg-context
ption[macOS] was > language-independent for me some time ago. (Now it seems to work like > \hyphenation.) > > In any case, \registerhyphenationexception seems to have issues with > ligatures: > > \setuphyphenation[method=traditional] > \registerhyphenationexception[steff-e

[NTG-context] strange issue with hyphens

2022-09-28 Thread Pablo Rodriguez via ntg-context
Dear list, I’m experiencing a weird issue with hyphenation: \setuphyphenation [method=traditional] \starttext \hyphenatedword{a-legibility-c} \sethyphenationfeatures [strict] \hyphenatedword{a-legibility-c} \stoptext I need the setup hyphenation commands to get underscore

Re: [NTG-context] Hyphenation in multi-language projects

2022-09-14 Thread Pablo Rodriguez via ntg-context
rhyphenationexception[macOS] was language-independent for me some time ago. (Now it seems to work like \hyphenation.) In any case, \registerhyphenationexception seems to have issues with ligatures: \setuphyphenation[method=traditional] \registerhyphenationexception[steff-en macOS] \registerhyp

Re: [NTG-context] t-vim module: no highlighting for custom filetypes

2021-05-23 Thread Aditya Mahajan
h > > had been requested in the past for t-vim). See the attached file. > > > > BTW, shouldn't we have `features=none` in the default mono font setup so > > that this doesn't happen anyways? > afaik we already do that > > (i'll add some more control, already added

Re: [NTG-context] t-vim module: no highlighting for custom filetypes

2021-05-23 Thread Hans Hagen
hypenated lines (something which had been requested in the past for t-vim). See the attached file. BTW, shouldn't we have `features=none` in the default mono font setup so that this doesn't happen anyways? afaik we already do that (i'll add some more control, already added \setuphyphenation[hyphen

[NTG-context] underscore hyphenation and hz

2021-05-10 Thread Pablo Rodriguez
, righthyphenchar="FE000] \definefontfeature [default] [default] [expansion=quality] \setupalign[hz] \sethyphenationfeatures[sha]% \setuphyphenation[method=traditional]% \starttext \hsize\zero

[NTG-context] underscore hyphenation not working

2021-05-08 Thread Pablo Rodriguez
alternative=sha, righthyphenchar="FE000] \sethyphenationfeatures[sha]% \setuphyphenation[method=traditional]% \starttext \hsize\zeropoint \tt abcde \stoptext I’m afraid that it isn’t working as expected with current latest from 2021.05.06 23:35. I wonder whether

Re: [NTG-context] Problem with word not hyphenating

2020-11-30 Thread Wolfgang Schuster
Hi Bruce, here you have a sample: \setuphyphenation[method=traditional] \registerhyphenationexception[en][re-im-ple-men-ta-tion] \starttext \startTEXpage[offset=1em] \hyphenatedword{re-implementation}\\ \hyphenatedword{re||implementation}\\ \hyphenatedword{re--impl

Re: [NTG-context] Problem with word not hyphenating

2020-11-30 Thread Pablo Rodriguez
uce, here you have a sample: \setuphyphenation[method=traditional] \registerhyphenationexception[en][re-im-ple-men-ta-tion] \starttext \startTEXpage[offset=1em] \hyphenatedword{re-implementation}\\ \hyphenatedword{re||implementation}\\ \hyphenatedword{re--implementation}\\ \hyphenatedword{reim

[NTG-context] does font expansion break -char.width?

2020-05-17 Thread Pablo Rodriguez
}, { "slot", 1, underscore }, } } end utilities.sequencers.appendaction("aftercopyingcharacters", "after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [under

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-24 Thread Benjamin Buchmuller
gt;> right = false, >> } >> >> local all = table.setmetatableindex({ }, function(t,k) >> return shared >> end) >> >> languages.hyphenators.traditional.installmethod("dna", >> f

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Rik Kabel
ary,word,n) return all end ) \stopluacode \definehyphenationfeatures   [dna]   [characters=all,    alternative=dna] \starttext \startframedtext[width=6cm,style=mono]   \sethyphenationfeatures[dna]   \setuphyphenation[method=traditional]   GATTGCTTAC

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Benjamin Buchmuller
> > languages.hyphenators.traditional.installmethod("dna", > function(dictionary,word,n) > return all > end > ) > \stopluacode > > \definehyphenationfeatures > [dna] > [characters=all, > alternative=dna] > >

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Wolfgang Schuster
end ) \stopluacode \definehyphenationfeatures [dna] [characters=all, alternative=dna] \starttext \startframedtext[width=6cm,style=mono] \sethyphenationfeatures[dna] \setuphyphenation[method=traditional] GATTGCTTACTCCTGGTTGG% TCTTACATTCTGTCGCCTC% CTACTAGAG

Re: [NTG-context] \registerhyphenationexception not working

2020-03-07 Thread Pablo Rodriguez
ght hyphenation: \setuplanguage[cs][righthyphenmin=2] \mainlanguage[cs] \setuphyphenation[method=traditional] \registerhyphenationexception[cs][cíl-em]% \starttext \startTEXpage[offset=1ex] \hyphenatedword{cílem} \stopTEXpage \stoptext The value for righthyphenmi

Re: [NTG-context] Hyphenation LuaTeX

2020-01-17 Thread Henning Hraban Ramm
> Am 2020-01-17 um 12:05 schrieb MANUEL GONZALEZ SUAREZ > : > > Hi: > When I compile a document with the following preamble: > > \mainlanguage[es] > %\setuphyphenation[method=traditional] > \usemodule[simplefonts] > \setuplanguage[es][patterns={es,agr}] >

[NTG-context] Hyphenation LuaTeX

2020-01-17 Thread MANUEL GONZALEZ SUAREZ
Hi: When I compile a document with the following preamble: \mainlanguage[es] %\setuphyphenation[method=traditional] \usemodule[simplefonts] \setuplanguage[es][patterns={es,agr}] \definefallbackfamily [mainface] [serif] [Old Standard] [range={greekandcoptic, greekextended}, force=yes, rscale

Re: [NTG-context] underscore hyphenation in LMTX

2019-04-29 Thread Hans Hagen
re }, } } end utilities.sequencers.appendaction("aftercopyingcharacters","after", "document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [whatever] [righthyphenchar="FE000] \setuphy

[NTG-context] underscore hyphenation in LMTX

2019-04-27 Thread Pablo Rodriguez
ndaction("aftercopyingcharacters","after", "document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [whatever] [righthyphenchar="FE000] \setuphyphenation[method=traditional] \sethyphenationfeatures[strict, whatever] \

Re: [NTG-context] How to repeat the hyphen?

2019-03-25 Thread Sam May
e is changed again. # > # > The following code works but I guess that must be some more sophisticated # > ConTeXt way. # > # > Best wishes, # > # > Tomá?? # > # > # > %% # > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox

Re: [NTG-context] optional hyphenation patterns in ancient Greek

2019-03-25 Thread Arthur Reutenauer
wrote the whole hyphenation routine in Lua in 2014, and users can switch to it with \setuphyphenation[method=traditional] The idea behind the name is apparently that the Lua code mimics the “traditional” way implemented in the TeX engine, and Hans envisages that other methods

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Tomas Hala
sticated # > ConTeXt way. # > # > Best wishes, # > # > Tomáš # > # > # > %% # > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframedtext\stop\par} # > \def\mybox#1{\myboxik{traditional}{#1}\myboxik{d

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Taco Hoekwater
e is changed again. > > The following code works but I guess that must be some more sophisticated > ConTeXt way. > > Best wishes, > > Tomáš > > > %% > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframe

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Tomas Hala
\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframedtext\stop\par} \def\mybox#1{\myboxik{traditional}{#1}\myboxik{default}{#1}\myboxik{expanded}{#1}\myboxik{original}{#1}\myboxik{tex}{#1}\myboxik{hyphenate}{#1}\myboxik{none}{#1}\par\thinrule} \starttext

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Taco Hoekwater
n inside (e.g. modro-zelený = blue-green), the > # > hyphen character must be repeated at the beginning of the new line > # > (modro-/-zelený). This rule is obligatory for Czech and Slovak > typesetting. > # > > # > I am able to implement this feature by defining a new comman

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Tomas Hala
e to implement this feature by defining a new command (see \def\= below) # > but it means that all appearances of "-" must be replaced (manually) in the source # > text. I tried all options of \setuphyphenation but no one gives the correct # > result. # > # > Is there any wa

Re: [NTG-context] How to repeat the hyphen?

2019-03-21 Thread Taco Hoekwater
e by defining a new command (see \def\= > below) > but it means that all appearances of "-" must be replaced (manually) in the > source > text. I tried all options of \setuphyphenation but no one gives the correct > result. > > Is there any way in ConTeXt how to set i

[NTG-context] How to repeat the hyphen?

2019-03-21 Thread Tomas Hala
\def\= below) but it means that all appearances of "-" must be replaced (manually) in the source text. I tried all options of \setuphyphenation but no one gives the correct result. Is there any way in ConTeXt how to set it by default? Best wishes, Tomáš %% MWE: \starttext\mainl

[NTG-context] bug with special hyphenation?

2018-02-08 Thread Pablo Rodriguez
ot;sha", function(dictionary,word,n) return all end ) \stopluacode \definehyphenationfeatures [sha] [characters=all, alternative=sha, righthyphenchar="FE000] \unexpanded\def\sha#1% {\begingroup\tt \s

Re: [NTG-context] how to hyphenate SHA512?

2017-07-10 Thread Pablo Rodriguez
a is fast enough anyway) > > local all = table.setmetatableindex({ }, function(t,k) > return shared > end) > > languages.hyphenators.traditional.installmethod("sha", > function(dictionary,word,n) > return all > end >

Re: [NTG-context] how to hyphenate SHA512?

2017-07-08 Thread Hans Hagen
\definehyphenationfeatures [sha] [characters=all, alternative=sha] % \unexpanded\def\sha#1% % {\begingroup %\sethyphenationfeatures[sha]% %#1% %\endgroup} % % \setuphyphenation[method=traditional] \unexpanded\def\sha#1% {\begingroup \sethyphenationfeatures[sha

Re: [NTG-context] how to hyphenate SHA512?

2017-07-08 Thread josephcanedo
acters", "after","document.addfunnyhyphen") \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \setuphyphenation [method=traditional] \sethyphenationfeatures [underscore] \starttext

Re: [NTG-context] how to hyphenate SHA512?

2017-07-08 Thread Pablo Rodriguez
\stopluacode \definehyphenationfeatures [underscore] [righthyphenchar="FE000] \setuphyphenation [method=traditional] \sethyphenationfeatures [underscore] \starttext \hsize\zeropoint hyphenation \stoptext Is there no way to define a language

Re: [NTG-context] Length range control of the last line of paragraph

2016-03-22 Thread Hans Hagen
, righthyphenmin=4] \enabletrackers[hyphenator.visualize] \setupalign[verytolerant,stretch] \dontcomplain \setuphyphenation [method=traditional] \edef\tufte{\cldloadfile{tufte}} \starttext \dorecurse{100}{ \hsize\dimexpr\textwidth-#1mm\relax \start \sethyphenationfeatures[words-1] \tufte \par

Re: [NTG-context] Length range control of the last line of paragraph

2016-03-22 Thread Hans Hagen
=4] \enabletrackers[hyphenator.visualize] \setupalign[verytolerant,stretch] \dontcomplain \sethyphenationfeatures [words] \setuphyphenation [method=traditional] \dorecurse{100}{\hsize\dimexpr\textwidth-#1mm\relax \input tufte \page} \stoptext currently this doesn't discourage breaks

Re: [NTG-context] bug in hyphenmin?

2015-12-14 Thread Pablo Rodriguez
On 12/13/2015 08:17 PM, Pablo Rodriguez wrote: > Dear list, > > I have the following sample: > > \setuplanguage[es][lefhyphenmin=1, righthyphenmin=1] > \mainlanguage[es] > > \definehyphenationfeatures >[givemefive] > [hyphenmin

[NTG-context] bug in hyphenmin?

2015-12-13 Thread Pablo Rodriguez
Dear list, I have the following sample: \setuplanguage[es][lefhyphenmin=1, righthyphenmin=1] \mainlanguage[es] \definehyphenationfeatures [givemefive] [hyphenmin=5] \setuphyphenation [method=traditional] \sethyphenationfeatures [strict

Re: [NTG-context] issue with latest beta

2015-11-02 Thread Pablo Rodriguez
. Pablo > On Sun, 01 Nov 2015 16:03:04 +0100, Pablo Rodriguez wrote: > >> Dear list, >> >> this basic sample crashes with latest beta on my computer: >> >> \setuphyphenation[method=traditional] >> >> \starttext >> \startalignment[

Re: [NTG-context] issue with latest beta

2015-11-02 Thread Procházka Lukáš Ing . - Pontex s . r . o .
atest beta on my computer: \setuphyphenation[method=traditional] \starttext \startalignment[flushright] iudad \stopalignment \stoptext Could anyone confirm whether it is a bug? Many thanks for your help, Pablo -- Ing. Lukáš Procházka | mailto:l...@pontex.c

[NTG-context] issue with latest beta

2015-11-01 Thread Pablo Rodriguez
Dear list, this basic sample crashes with latest beta on my computer: \setuphyphenation[method=traditional] \starttext \startalignment[flushright] iudad \stopalignment \stoptext Could anyone confirm whether it is a bug? Many thanks for your help, Pablo -- http

Re: [NTG-context] issue with font and lua code

2015-07-24 Thread Hans Hagen
] [righthyphenchar=FE000] \setuphyphenation [method=traditional] \sethyphenationfeatures [strict] \definefontfamily[svb][rm][SV Basic Manual] \setupbodyfont[svb] \starttext \hyphenatedword{legibility} \stoptext For some reason, the font gives the following

[NTG-context] issue with font and lua code

2015-07-20 Thread Pablo Rodriguez
}, } } end utilities.sequencers.appendaction(aftercopyingcharacters, after,document.addfunnyhyphen) \stopluacode \definehyphenationfeatures [underscore] [righthyphenchar=FE000] \setuphyphenation [method=traditional

Re: [NTG-context] lua code prevents compilation

2015-04-01 Thread Hans Hagen
][TypographyTribute] \definehyphenationfeatures[underscore][righthyphenchar=FE000] \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \setupbodyfont[ornamenta] \starttext \hsize\zeropoint {\sethyphenationfeatures[underscore]\tt pandoc} A \stoptext If you uncomment the line

Re: [NTG-context] lua code prevents compilation

2015-04-01 Thread Pablo Rodriguez
[underscore][righthyphenchar=FE000] \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \setupbodyfont[ornamenta] \starttext \hsize\zeropoint {\sethyphenationfeatures[underscore]\tt pandoc} A \stoptext If you uncomment the line with the font definition, font loading crashes compilation

Re: [NTG-context] undefined \sethyphenationfeatures?

2015-03-28 Thread Hans Hagen
On 3/28/2015 7:29 PM, Pablo Rodriguez wrote: Hans, I”m afraid that beta from 2015.03.28 16:30 removes \sethyphenationfeatures: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \starttext \input zapf \stoptext Is this really intended? typo

[NTG-context] undefined \sethyphenationfeatures?

2015-03-28 Thread Pablo Rodriguez
Hans, I”m afraid that beta from 2015.03.28 16:30 removes \sethyphenationfeatures: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \starttext \input zapf \stoptext Is this really intended? Many thanks for your help, Pablo -- http://www.ousia.tk

Re: [NTG-context] undefined \sethyphenationfeatures?

2015-03-28 Thread Wolfgang Schuster
Am 28.03.2015 um 19:29 schrieb Pablo Rodriguez oi...@gmx.es: Hans, I”m afraid that beta from 2015.03.28 16:30 removes \sethyphenationfeatures: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \starttext \input zapf \stoptext Is this really

Re: [NTG-context] Bug with ligatures (EBGaramond) and \mainlanguage[es]

2015-03-26 Thread Hans Hagen
. You need a fairly new beta. Add the following lines at the top of your preamble: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] I hope it helps, It's not a bug actually but a side effect. The way fonts implement ligatures is rather diverse (and even not always

Re: [NTG-context] Bug with ligatures (EBGaramond) and \mainlanguage[es]

2015-03-26 Thread Pablo Rodriguez
at the top of your preamble: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] I hope it helps, Pablo %% % remove the comment below to see the effect on ligatures. %\mainlanguage[es

Re: [NTG-context] buggy extra space after ff ligature

2015-03-24 Thread Otared Kavian
:56, Pablo Rodriguez oi...@gmx.es wrote: Dear list, I’m afraid I’ve hit a bug: \setuphyphenation[method=traditional] \definefontfeature[default][default][itlc=yes] \setupitaliccorrection[global,always] \setuphead[section][style=\it] \starttext \section{Different

[NTG-context] buggy extra space after ff ligature

2015-03-23 Thread Pablo Rodriguez
Dear list, I’m afraid I’ve hit a bug: \setuphyphenation[method=traditional] \definefontfeature[default][default][itlc=yes] \setupitaliccorrection[global,always] \setuphead[section][style=\it] \starttext \section{Different Efficiencies} \section{Different Effectivity

Re: [NTG-context] \setupbackend and manual hyphenation

2015-02-12 Thread Hans Hagen
On 2/12/2015 5:10 PM, Axel Kielhorn wrote: Am 12.02.2015 um 16:10 schrieb Hans Hagen pra...@wxs.nl: for the moment use \setuphyphenation[method=expanded] This works in the current beta, but not with the stable version in TeXLive 2014. indeed, as there is new hyphenation related code

Re: [NTG-context] \setupbackend and manual hyphenation

2015-02-12 Thread Hans Hagen
errorerror on line 1 in file /Volumes/Macintosh HD/Users/axel/Documents/Text/Dokumente_LaTeX/context/Dante 2015/Dominik Wagenführ - ePub/epub/epub_bug.tex: fixed in next beta (not uploaded before Alan and I reach a next stage in publications) for the moment use \setuphyphenation[method

Re: [NTG-context] \setupbackend and manual hyphenation

2015-02-12 Thread Axel Kielhorn
Am 12.02.2015 um 16:10 schrieb Hans Hagen pra...@wxs.nl: for the moment use \setuphyphenation[method=expanded] This works in the current beta, but not with the stable version in TeXLive 2014. It doesn't matter since I need the beta to create epub, just wanted to mention it. Thanks

Re: [NTG-context] underscore hyphenation

2014-12-11 Thread Pablo Rodriguez
] \definefontfamily[mainface][mono][Mechanica] \setupbodyfont[mainface, 14pt] \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=FE000] \setuphyphenation[method=traditional

Re: [NTG-context] two issues with new hyphenator

2014-12-11 Thread Pablo Rodriguez
(aftercopyingcharacters,after,document.addfunnyhyphen) \stopluacode \definehyphenationfeatures [url] [characters=all, righthyphenchar=FE000, alternative=url] \setuphyphenation[method=traditional] \unexpanded\def\hyphenatedurl#1% {\dontleavehmode \begingroup

Re: [NTG-context] two issues with new hyphenator

2014-12-10 Thread Pablo Rodriguez
[TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=FE000] \setuphyphenation [method=traditional] \unexpanded\def\TexC#1% {\dontleavehmode\begingroup \sethyphenationfeatures

[NTG-context] underscore hyphenation

2014-12-10 Thread Pablo Rodriguez
][GaramondNo8] \definefontfamily[mainface][mono][Mechanica] \setupbodyfont[mainface, 14pt] \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=FE000] \setuphyphenation[method=traditional

Re: [NTG-context] underscore hyphenation

2014-12-10 Thread Hans Hagen
] \setupbodyfont[mainface, 14pt] \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=FE000] \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \unexpanded\def

Re: [NTG-context] two issues with new hyphenator

2014-12-10 Thread Hans Hagen
] \setuphyphenation[method=traditional] \unexpanded\def\hyphenatedurl#1% {\dontleavehmode \begingroup \tt \sethyphenationfeatures[url]% #1% \endgroup} \starttext \hsize5mm \hyphenatedurl{http://www.pragma-ade.nl} \stoptext Many thanks for your help again, Pablo \startluacode

Re: [NTG-context] two issues with new hyphenator

2014-12-08 Thread Pablo Rodriguez
=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=_] \setuphyphenation [method=traditional] \unexpanded\def\TexC#1% {\dontleavehmode\begingroup \sethyphenationfeatures[whatever]% \normalexpanded{\TeXcode

Re: [NTG-context] two issues with new hyphenator

2014-12-08 Thread Hans Hagen
[always] [always] [funnyhyphen=yes] \definefontfeature[none] [none] [funnyhyphen=yes] \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=FE000] \setuphyphenation [method=traditional

Re: [NTG-context] two issues with new hyphenator

2014-12-06 Thread Pablo Rodriguez
\definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=_] \setuphyphenation [method=traditional] \unexpanded\def\TexC#1% {\dontleavehmode\begingroup \sethyphenationfeatures

Re: [NTG-context] two issues with new hyphenator

2014-12-06 Thread Hans Hagen
\prehyphencharFE000 \hsize 1mm averylongword \stoptext Many thanks for your help, Pablo \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=_] \setuphyphenation [method=traditional

Re: [NTG-context] two issues with new hyphenator

2014-12-05 Thread Pablo Rodriguez
is already there, this wraps it in a macro) Many thanks for the new beta from today, Hans. I’m afraid I might have hit a bug: \setuphyphenation[method=traditional] \registerhyphenationexception[Nietz-sche Pa-blo pa-lo water a-b a-c] \starttext \hsize 1mm

Re: [NTG-context] two issues with new hyphenator

2014-12-05 Thread Pablo Rodriguez
to extend the mechanism to support this ... Many thanks for your help, Hans. I’m afraid that I get a zero in the next line after the underscore. And I get two zeros (one at the end and one at the begining) with strict hyphenation: \setuphyphenation[method=traditional] \sethyphenationfeatures

Re: [NTG-context] two issues with new hyphenator

2014-12-05 Thread Hans Hagen
: \setuphyphenation[method=traditional] \sethyphenationfeatures[strict] \starttext \input knuth \stoptext BTW, in your sample below, how can I get the underscore under the previous character? (Otherwise, the underscore has no use.) Hm, that was the idea of the example i sent earlier

Re: [NTG-context] two issues with new hyphenator

2014-12-04 Thread Hans Hagen
it? it's no big deal to extend the mechanism to support this ... \definetype [TeXcode] [option=TEX, compact=absolute, lines=hyphenated] \definehyphenationfeatures [whatever] [righthyphenchar=_] \setuphyphenation [method=traditional] \unexpanded\def\TexC#1% {\dontleavehmode\begingroup

[NTG-context] two issues with new hyphenator

2014-12-03 Thread Pablo Rodriguez
Many thanks for your new beta, Hans. From the previous beta with the new hyphenator, I have two issues. With the new hyphenator, \hyphenation isn’t honored, such as in this sample: \setuphyphenation[method=traditional] \hyphenation{Nietz-sche} \starttext \hsize\zeropoint

Re: [NTG-context] two issues with new hyphenator

2014-12-03 Thread Hans Hagen
On 12/3/2014 7:48 PM, Pablo Rodriguez wrote: Many thanks for your new beta, Hans. From the previous beta with the new hyphenator, I have two issues. With the new hyphenator, \hyphenation isn’t honored, such as in this sample: \setuphyphenation[method=traditional] \hyphenation{Nietz

Re: [NTG-context] two issues with new hyphenator

2014-12-03 Thread Hans Hagen
On 12/3/2014 7:48 PM, Pablo Rodriguez wrote: Many thanks for your new beta, Hans. From the previous beta with the new hyphenator, I have two issues. With the new hyphenator, \hyphenation isn’t honored, such as in this sample: \setuphyphenation[method=traditional] \hyphenation{Nietz

Re: [NTG-context] beta

2014-12-01 Thread Pablo Rodriguez
On 11/26/2014 08:28 PM, Hans Hagen wrote: [...] \setuphyphenation[method=traditional] enables it and as by default we are a bit more tolerant to what a word is, you can enforce a more strict behaviour with Hans, sorry for not having answered before, but I found that this new setup doesn’t

Re: [NTG-context] Omitting hyphenation

2010-06-24 Thread Matija Šuklje
[de]\hyphenation{expection list for german} but it would be nice to combine both in a single command, e.g. \setuphyphenation{exception list for the current active language} % like \hyphenation{...} \setuphyphenation[de]{exception list for german} % like \language[de]\hyphenation

Re: [NTG-context] Omitting hyphenation

2010-06-24 Thread Wolfgang Schuster
[en]\hyphenation{expection list for english} \language[de]\hyphenation{expection list for german} but it would be nice to combine both in a single command, e.g. \setuphyphenation{exception list for the current active language} % like \hyphenation{...} \setuphyphenation[de]{exception list

Re: [NTG-context] Omitting hyphenation

2010-06-22 Thread Hans Hagen
in a single command, e.g. \setuphyphenation{exception list for the current active language} % like \hyphenation{...} \setuphyphenation[de]{exception list for german} % like \language[de]\hyphenation{...} how about \startexceptions[de] ... \stopexceptions

Re: [NTG-context] Omitting hyphenation

2010-06-21 Thread Wolfgang Schuster
explain what i mean: when you try to make hyphenation exceptions for different languages you need currently \language[en]\hyphenation{expection list for english} \language[de]\hyphenation{expection list for german} ... but it would be nice to combine both in a single command, e.g. \setuphyphenation