Hi Mark, how are you?
I'm jumping on the subject, as I too have been trying to use a tab
file to generate a cdf for a custom array. the script sub-mentioned
worked fine as I do get back a cdf file. However, when i re-allocate
this to my raw data prior to rma normalise i got an error:
>flat2Cdf(file="csv.merged.2",
>chipType="Malaria",ucol=6,gcol=5,col.class=c("integer","character")[c(1,1,1,2,2,2)])
>Malariacdf <- make.cdf.env("Malaria.CDF")
>raw...@cdfname <- "Malariacdf"
>eset3D7 <- rma(raw3D7)
Error in .local(object, ...) : subscript out of bounds
after looking into the cdf using readCdf(), all categories are
respected and definitely look like an original cdf from Affy.
exemple:
$`chr1.rRNA-1-28s`
$`chr1.rRNA-1-28s`$groups
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$x
[1] 19 203 325 373 598 667
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$y
[1] 69 48 115 255 493 14
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$pbase
[1] "A" "A" "A" "A" "A" "A"
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$tbase
[1] "T" "T" "T" "T" "T" "T"
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$atom
[1] 0 1 2 3 4 5
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$indexpos
[1] 0 1 2 3 4 5
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$groupdirection
[1] "antisense"
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$natoms
[1] 6
$`chr1.rRNA-1-28s`$groups$`chr1.rRNA-1-28s`$ncellsperatom
[1] 1
$`chr1.rRNA-1-28s`$unittype
[1] "expression"
$`chr1.rRNA-1-28s`$unitdirection
[1] "nodirection"
$`chr1.rRNA-1-28s`$natoms
[1] 6
$`chr1.rRNA-1-28s`$ncells
[1] 6
$`chr1.rRNA-1-28s`$ncellsperatom
[1] 1
$`chr1.rRNA-1-28s`$unitnumber
[1] 1
I used this script as it looked very straightforward. So after
filtering up my original probesets, I made the tab file containing
Probe_ID X Y Probe_Sequence Group_ID and Unit_ID.
exemple:
Probe_ID X Y Probe_Sequence Group_ID Unit_ID
1 1 103 aatgatgaaatcaagacgtttagct PFB0955w PFB0955w
2 1 112 caattacacagaatctctttcagtg MAL13P1.309
MAL13P1.309
The original probeset comes with 1 probe as a probeset (~600,000),
while i want to group probes as per gene (~5000) rather than
individual probes (and not all probes map on the w strand, or within a
CDS).
I would welcome any suggestion at all!
Thank you very much for your help
Celine
On Jul 25, 1:07 am, "Mark Robinson" <[email protected]> wrote:
> Hi Naresh.
>
> That particular script (flat2Cdf.R) creates a PM-only CDF.
>
> But, if you understand the format of a CDF file -- you might read in the
> your original CDF with readCdf() from the 'affxparser' package to
> understand it -- then you should be able to modify the script to include
> MM probes.
>
> Keep in mind that we make this script available to explain what we have
> done in the past, not as a cure-all for CDF creation.
>
> Cheers,
> Mark
>
>
>
> > Hello Group,
>
> > I created custom cdf for HG-U133_Plus_2 array by redefining probesets
>
> (mapping original probes to exons and redefining probesets according to
> the probes mapping to the same exons considered as new probe set) . I
> downloaded Oiginal CDF fo this array from affy website.I tried to access
> a particular probe i'm able to get both PM and MM values but for my
> customized CDF i'm getting only PM values for a probe but not MM
> values.So could you please confirm whether this customized CDF does not
> contain MM values or i'm doing a mistake in creating CDF.
>
>
>
> > If there is a mistake please suggest me some way to rectify it.
> > I created CDF using
> > Source :
> >http://groups.google.com/group/aroma-affymetrix/web/creating-cdf-file...
>
> > Thanks and Regards
> > Naresh P
--~--~---------~--~----~------------~-------~--~----~
When reporting problems on aroma.affymetrix, make sure 1) to run the latest
version of the package, 2) to report the output of sessionInfo() and
traceback(), and 3) to post a complete code example.
You received this message because you are subscribed to the Google Groups
"aroma.affymetrix" group.
To post to this group, send email to [email protected]
To unsubscribe from this group, send email to
[email protected]
For more options, visit this group at
http://groups.google.com/group/aroma-affymetrix?hl=en
-~----------~----~----~----~------~----~------~--~---
