[I'm reply to each of your questions in three separate threads to make it easier to follow]
Hi. On Fri, Nov 30, 2012 at 12:44 PM, Sam Danziger <sam.danzi...@gmail.com> wrote: > I've been trying to use FIRMA analysis > (http://www.aroma-project.org/vignettes/FIRMA-HumanExonArrayAnalysis) on my > mouse arrays ( > Mouse Exon 1.0 ST Array - > http://aroma-project.org/chipTypes/MoEx-1_0-st-v1). > > It looks like the scripts have completed successfully, but I have a few > questions: > 1) How can I figure out which genes/exons correspond with the "unitName" and > "groupName" fields returned by "extractDataFrame(fs, addNames=TRUE)"? > > http://www.aroma-project.org/vignettes/UsingGenomeGraphsWithFIRMA implies > that I can download a "NetAffx tabular text files" from Ayymetrix and use > that. However, I cannot get Affymetrix to provide me with a login to get > that file. I don't see why you shouldn't be able to get one - when I registered many years ago, it was pretty straightforward. Are you saying they're not approving your registration, or don't they even get back to you? > I hoped that I could load ‘MoEx-1_0-st-v1,HB20100926.acs’ and use > that to get enough probe information to reconstruct the names using annmap, > but I cannot figure out how to load the .acs file. Example: > library("aroma.affymetrix"); > acs <- AromaCellSequenceFile$byChipType("MoEx-1_0-st-v1"); > acs; # ... # Total number of cells (=probes) on the chip > nbrOfCells(acs); [1] 6553600 # A subset of the cells > cells <- c(100201:100205); > seqs <- readSequences(acs, cells=cells); > seqs > seqs [1] "GAACAGAGGAGAGGTGGGCGGAGCC" "AAGACTAGAACTTTGACAGACAGCC" [3] "CGTAGGTCATTTCCTCACAGACGCC" "TAAAGGTTGTGTCTATCACTGGGCC" [5] "AGATACGTAGGACAGATTCACGGCC" > seqsX <- readSequenceMatrix(acs, cells=cells); > seqsX [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] "G" "A" "A" "C" "A" "G" "A" "G" "G" "A" [2,] "A" "A" "G" "A" "C" "T" "A" "G" "A" "A" [3,] "C" "G" "T" "A" "G" "G" "T" "C" "A" "T" [4,] "T" "A" "A" "A" "G" "G" "T" "T" "G" "T" [5,] "A" "G" "A" "T" "A" "C" "G" "T" "A" "G" [,11] [,12] [,13] [,14] [,15] [,16] [,17] [,18] [,19] [1,] "G" "A" "G" "G" "T" "G" "G" "G" "C" [2,] "C" "T" "T" "T" "G" "A" "C" "A" "G" [3,] "T" "T" "C" "C" "T" "C" "A" "C" "A" [4,] "G" "T" "C" "T" "A" "T" "C" "A" "C" [5,] "G" "A" "C" "A" "G" "A" "T" "T" "C" [,20] [,21] [,22] [,23] [,24] [,25] [1,] "G" "G" "A" "G" "C" "C" [2,] "A" "C" "A" "G" "C" "C" [3,] "G" "A" "C" "G" "C" "C" [4,] "T" "G" "G" "G" "C" "C" [5,] "A" "C" "G" "G" "C" "C" attr(,"map") <NA> A C G T 00 01 02 03 04 [snip] > Thank you, > -Sam > > -- > When reporting problems on aroma.affymetrix, make sure 1) to run the latest > version of the package, 2) to report the output of sessionInfo() and > traceback(), and 3) to post a complete code example. > > > You received this message because you are subscribed to the Google Groups > "aroma.affymetrix" group with website http://www.aroma-project.org/. > To post to this group, send email to aroma-affymetrix@googlegroups.com > To unsubscribe and other options, go to http://www.aroma-project.org/forum/ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups "aroma.affymetrix" group with website http://www.aroma-project.org/. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe and other options, go to http://www.aroma-project.org/forum/
