Hello,
I know this has been addressed before, but I am still not clear about it
and not sure whether it was solved. I am having trouble getting gcRMA to
work with a Human Transcriptome Array 2.0. I created custom CDFs based on
probes mapped to 5'utr only. Please find my R code, output/error.
sessionInfo below.
Could you help me with the following questions, I would really appreciate:
1. Regarding probe_tab file required for GcRmaBackgroundCorrection, does it
have to have specific column names? When I change first column name from
Probe Set Name to Probe SetName I am getting completely different error
(bit more reminiscent of error I read about in other post on this group
from 2010 regarding GcRmaBackgroundCorrection).
Error: Either argument 'names' or 'pattern' must be specified.
In addition: Warning message:
In readDataFrame.TabularTextFile(ptf, colClasses =
c(`^(unitName|probeSetID)$` = "character"), :
Argument 'rows' was out of range [1,0]. Ignored rows beyond this range.
2. As I understand from your previous posts, the solution would be to
download affymetrix cdf for background correction purposes. Could you
explain me why it is needed and can't be done using customCDF? Also if I
would follow that approach, how it would affect if only small subset of
probes is used in the analysis.
Thank you
Best wishes
Krzysztof
This is my code:
# Read all the cel files that are there in your folder
cdf <- AffymetrixCdfFile$byChipType(chipType, tags='binary')
cs <- AffymetrixCelSet$byName(name, cdf=cdf, verbose=verbose)
# Read a file with cel files of experiment design - it deals with >CEL than
currently being used
mt <- match(design[,1], getNames(cs))
ds <- extract(cs, mt)
setCdf(ds, cdf)
# Background correction
bc <- GcRmaBackgroundCorrection(ds,type="affinities")
csBC <- process(bc, verbose=-20)
#Here is output:
Background correcting data set...
Background correcting data set...
Already background corrected for "optical" effects
Background correcting data set...done
Computing probe affinities (independent of data)...
Computing GCRMA probe affinities...
Chip type: HTA2_hg19_refseq_fiveutr
Number of units: 33640
Locating the cell sequence annotation data file...
Locating the cell sequence annotation data file...done
Computing GCRMA probe affinities...done
Computing GCRMA probe affinities...
Number of units: 33640
Identify PMs and MMs among the CDF cell indices...
logi [1:822842] TRUE TRUE TRUE TRUE TRUE TRUE ...
Mode TRUE NA's
logical 822842 0
MMs are defined as non-PMs
Number of PMs: 822842
Number of MMs: 0
Identify PMs and MMs among the CDF cell indices...done
Reading probe-sequence data...
Retrieving probe-sequence data...
Chip type (full): HTA2_hg19_refseq_fiveutr,binary
Locating probe-tab file...
Chip type: HTA2_hg19_refseq_fiveutr
AffymetrixProbeTabFile:
Name: HTA2_hg19_refseq_fiveutr
Tags:
Full name: HTA2_hg19_refseq_fiveutr
Pathname:
annotationData/chipTypes/HTA2_hg19_refseq_fiveutr/HTA2_hg19_refseq_fiveutr_probe_tab
File size: 43.03 MiB (45125121 bytes)
RAM: 0.01 MB
Number of data rows: NA
Columns [6]: 'unitName', 'probeXPos', 'probeYPos',
'interrogationPosition', 'probeSequence', 'targetStrandedness'
Number of text lines: NA
AffymetrixCdfFile:
Path: annotationData/chipTypes/HTA2_hg19_refseq_fiveutr
Filename: HTA2_hg19_refseq_fiveutr.cdf
File size: 16.44 MiB (17238612 bytes)
Chip type: HTA2_hg19_refseq_fiveutr
RAM: 0.00MB
File format: v4 (binary; XDA)
Dimension: 2572x2680
Number of cells: 6892960
Number of units: 33640
Cells per unit: 204.90
Number of QC units: 0
Locating probe-tab file...done
Validating probe-tab file against CDF...
Number of records read: 1
Data read:
'data.frame': 1 obs. of 1 variable:
$ unitName: chr "NM_000015"
Unit name:
chr "NM_000015"
Unit index: 2
probeXPos probeYPos probeSequence
1 2493 329 CTTCCCTTGCAGACTTTGGAAGGGA
(x,y):
[1] 2493 329
Validating probe-tab file against CDF...done
Reading (x,y,sequence) data...
Reading (x,y,sequence) data...done
Validating (x,y) against CDF dimension...
CDF dimension:
nbrOfRows nbrOfColumns
2572 2680
[2016-03-31 10:22:42] Exception: Detected probe x position out of range
[0,2572]:
annotationData/chipTypes/HTA2_hg19_refseq_fiveutr/HTA2_hg19_refseq_fiveutr_probe_tab
at #08. getProbeSequenceData.AffymetrixCdfFile(this, safe = safe, verbose
= verbose)
- getProbeSequenceData.AffymetrixCdfFile() is in environment
'aroma.affymetrix'
at #07. getProbeSequenceData(this, safe = safe, verbose = verbose)
- getProbeSequenceData() is in environment 'aroma.affymetrix'
at #06. computeAffinities.AffymetrixCdfFile(cdf, ..., verbose =
less(verbose))
- computeAffinities.AffymetrixCdfFile() is in environment
'aroma.affymetrix'
at #05. computeAffinities(cdf, ..., verbose = less(verbose))
- computeAffinities() is in environment 'aroma.affymetrix'
at #04. calculateAffinities.GcRmaBackgroundCorrection(this, verbose =
less(verbose))
- calculateAffinities.GcRmaBackgroundCorrection() is in
environment 'aroma.affymetrix'
at #03. calculateAffinities(this, verbose = less(verbose))
- calculateAffinities() is in environment 'aroma.affymetrix'
at #02. process.GcRmaBackgroundCorrection(bc, verbose = -20)
- process.GcRmaBackgroundCorrection() is in environment
'aroma.affymetrix'
at #01. process(bc, verbose = -20)
- process() is in environment 'aroma.core'
Error: Detected probe x position out of range [0,2572]:
annotationData/chipTypes/HTA2_hg19_refseq_fiveutr/HTA2_hg19_refseq_fiveutr_probe_tab
Validating (x,y) against CDF dimension...done
Retrieving probe-sequence data...done
Reading probe-sequence data...done
Computing GCRMA probe affinities...done
Computing probe affinities (independent of data)...done
Background correcting data set...done
#Session info
R version 3.2.3 (2015-12-10)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.1 (El Capitan)
locale:
[1] en_GB.UTF-8/en_GB.UTF-8/en_GB.UTF-8/C/en_GB.UTF-8/en_GB.UTF-8
attached base packages:
[1] stats4 parallel stats graphics grDevices utils datasets
methods base
other attached packages:
[1] GO.db_3.2.2 org.Hs.eg.db_3.2.3 RSQLite_1.0.0
DBI_0.3.1 AnnotationDbi_1.32.3
[6] Biobase_2.30.0 Sushi_1.8.0 moments_0.14
entropy_1.2.1 zoo_1.7-12
[11] biomaRt_2.26.1 reshape2_1.4.1 rtracklayer_1.30.3
GenomicRanges_1.22.4 GenomeInfoDb_1.6.3
[16] IRanges_2.4.8 S4Vectors_0.8.11 BiocGenerics_0.16.1
FIRMAGene_0.9.8 dplyr_0.4.3
[21] stringr_1.0.0 data.table_1.9.6 aroma.light_3.0.0
aroma.affymetrix_3.0.0 aroma.core_3.0.0
[26] R.devices_2.14.0 R.filesets_2.10.0 R.utils_2.2.0
R.oo_1.20.0 affxparser_1.42.0
[31] R.methodsS3_1.7.1
loaded via a namespace (and not attached):
[1] Rcpp_0.12.3 lattice_0.20-33 listenv_0.6.0
Rsamtools_1.22.0
[5] Biostrings_2.38.4 assertthat_0.1 digest_0.6.9
R6_2.1.2
[9] plyr_1.8.3 chron_2.3-47
futile.options_1.0.0 R.huge_0.9.0
[13] BiocInstaller_1.20.1 zlibbioc_1.16.0
preprocessCore_1.32.0 splines_3.2.3
[17] BiocParallel_1.4.3 gcrma_2.42.0 RCurl_1.95-4.8
base64enc_0.1-3
[21] aroma.apd_0.6.0 R.rsp_0.21.0 globals_0.6.1
SummarizedExperiment_1.0.2
[25] DNAcopy_1.44.0 codetools_0.2-14
matrixStats_0.50.1 XML_3.98-1.4
[29] future_0.12.0 GenomicAlignments_1.6.3 bitops_1.0-6
grid_3.2.3
[33] affy_1.48.0 magrittr_1.5 stringi_1.0-1
XVector_0.10.0
[37] affyio_1.40.0 PSCBS_0.61.0
futile.logger_1.4.1 lambda.r_1.1.7
[41] tools_3.2.3 R.cache_0.12.0
--
--
When reporting problems on aroma.affymetrix, make sure 1) to run the latest
version of the package, 2) to report the output of sessionInfo() and
traceback(), and 3) to post a complete code example.
You received this message because you are subscribed to the Google Groups
"aroma.affymetrix" group with website http://www.aroma-project.org/.
To post to this group, send email to aroma-affymetrix@googlegroups.com
To unsubscribe and other options, go to http://www.aroma-project.org/forum/
---
You received this message because you are subscribed to the Google Groups
"aroma.affymetrix" group.
To unsubscribe from this group and stop receiving emails from it, send an email
to aroma-affymetrix+unsubscr...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
