Hi all,
This new features seem just what I was looking for. However I still have some
doubts:
Is there a way to set the "Frame Line Features..." options at start-up (through
the options file)?
I've noticed that relating sequence with feature is only possible when the FASTA
sequences are inside the GFF file. This is not so handy when your handling big
files, such as entire genomes. Is it possible to relate both things when you add
each entry separately?
I also have some memory problems when loading an entire genome + GFF
annotations. How much memory do you think it would be necessary for artemis to
run? 2Gb?
A minor change, when loading a multi-FASTA file, would also come in hand.
Artemis, currently, interprets the whole '>' string as the sequence ID. It would
be nicer if it was just until the first SPACE (the standard behaviour). That way
it is possible to add some description.
thanks in adv,
FG
Tim Carver wrote:
Hi Filipe
It sounds like you are better off using the "Frame Line Features..." option.
This allows you to define what features you want displayed on the frame
lines. I think the other option is there for convenience and for when it is
suitable.
In the development version of Artemis you can have GFF3 with multiple
sequences and the coordinates for the features relating to each (as below).
E.g.
## gff-version 3
##
contig1 foo CDS 3 32 . - .
ID=cds1;colour=8
contig1 foo3 CDS 3 32 . + .
ID=cds3;colour=8
contig2 foo2 CDS 17 19 . + .
ID=cds2;colour=2
###
##FASTA
contig1
gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt
tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga
contig2
gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt
tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga
Hope this helps.
Regards
Tim
On 1/2/08 16:17, "Filipe Garrett" <[EMAIL PROTECTED]> wrote:
Hi all,
I've been trying to use Artemis with a recent Ensembl files from Anopheles
(3.46).
However, some things came to my atention.
When I activate the "All features On Frame Lines" every feature is depicted on
its correspondent lane. But why are exons also places on the frame lines? The
exons don't have any frame! Shouldn't the frameless features be maintained on
the central lines (or on a non-frame line)?
The same thing happens when adding a multi-FASTA file. A concatenated sequence
is loaded and several features, labelled "fasta_record", are created. Again
this
features are placed as having frame!
Is this a bug or am I forgetting something?
Another thing that I've noticed is that there is no use for the "seqname"
field
in the GFF files. When placing features only the position and strand are taken
into account, with all of them being placed in its positions but counting from
the beginning of the concatenated sequence.
Is there a way to link the "seqname" field with the "fasta_record" feature so
that each feature is placed on the correct sequence? The idea would be to load
a
single GFF with the annotations for all the sequences present in a
multi-FASTA.
SEQ1 EMBL atg 103 105 . + 0
SEQ1 EMBL cds 103 171 . + 0
SEQ1 EMBL stop 172 174 . + .
SEQ2 EMBL atg 173 175 . + .
SEQ2 EMBL cds 173 258 . + .
SEQ2 EMBL stop 259 261 . + 0
thanks in adv,
FG
_______________________________________________
Artemis-users mailing list
[email protected]
http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
_______________________________________________
Artemis-users mailing list
[email protected]
http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
