Hi,
I was trying Artemis to view some annotations I have in a multiFASTA and GFF3 file. In my use case, it is not common to have this type of data. I noticed a problem though, in that Artemis assigns all the GFF features to the first sequence in the FASTA file (see attached screenshot). After some research, I found that this issue has been reported 2-3 years ago:
http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00468.html
http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00401.html
Any chance that this will be fixed?
Regards,
Florent

PS/ I attached a subset of the contigs and annotations that illustrate the bug.

##gff-version  3
NODE_11_length_1349_cov_136.672348      Prodigal_v2.50  CDS     1       114     
24.0    -       0       
ID=8_1;cscore=7.85;partial=10;rbs_motif=AGGAG;rbs_spacer=5-10bp;rscore=14.24;score=24.0,24.0,25.17;sscore=17.32;start_type=ATG;tscore=3.88;uscore=-1.94
NODE_13_length_11123_cov_152.177734     FIG     CDS     25      153     .       
+       1       ID=fig|6666666.7046.peg.4;Name=hypothetical protein

>NODE_11_length_1349_cov_136.672348
GCCCCAAAGTTGCTGGCGGGCCAGCTCGACCACGGTGCCAGCGCCTTGAACGGTGTAGCC
GCTCGGGTCGGTGTAGGTTAGAACGGTGGCGGTGTTGGCGGGTTGCTTGTGCATGTCGGT
CTCTCCTTAAACCACAGCGTCGGCTTCAACCGCATCGCTGTATGCTTCTGCGTAGGCCTC
GCAGGCGTCTTGCAGTTGCAGCGAAGCGATGCGGATTCGCCCTTGCACGCCTTCCCAGCG
CTCGTCCTGCGTGTCGTAAGCCAGCAGGTCCGTAACACAGCGGTCCAGGAACGCGCGGCG
CACCTTAACTTCTTCAGCGGCCTTGTTAAGGTTGAAGCGAGCGATTTCAGCGAGGGTAGC
CATTTCGGTCTCCAGTGCGTTTGCGTCTATGCA
>NODE_13_length_11123_cov_152.177734
GCGCCGGCTTCCATCTCCGAAGCGATGGAGATCGGCAAGGCCCGCAGCCTGAACGAAGCC
AACATGCGCGCTGAATACGCTCGCTGGCGGAAGTTCCACGGCATCAGCGGCCGTATCTCG
GCGCCGAAGCCTGAGGCTGCTACCGAGGGCTAAAATCTAGCCTCGCTGCCCGAAACCTGC
TAGGGGTTGTTTTCCGGCAACCCCTAGCCACCTCCCGGAGCTCGATATGACCTTCACGGT
CAATACTCAGCCCATCGAAAAGCGTGTGTCGCACCCCGAGGGCAAGCTGTCTGTTCACAG
CATCTTCTACACAATCCAAGGTGAGGGACCGTTCTGCGGCACGCCGGCGGTCTTTATTCG
TCTTGCGGGGTGCAACCTCCAGTGCCCGGGCTGCGACACCGAATACACTTCGGGGCGCCG
GGAGGCGGGAGCTTATGAGATCCTGTTCGAGGTCGATAAACTGATCCGCAAGGATGGGTG
GAGAAAGGGGCTGGTCGTAATCACCGGCGGGGAACCTTTCCGTCAGGACATCGGAGACCT
GATCAACGTCCTGACACTTCACGGATATTACGTCCAGATCGAATCGAACGGCACGCTGCC
CCCGCCCCCTGTCCTATGGAACCACAACACCGCCGTTCGGAGCGGTGCCTATCTGGTGAT
CAGCCCGAAGACAGGCAAGATTAATCCGCTGTCACTGGCCGCAGCGTGCGCGCTCAAGTA
TGTCGGGGAATGGGGCGACCTTGCCGAGGACGACGGGTTGCCCAACCATGCGCTCCGCCA
CACCGCCAACCCCCGGCTTGCGCGGCCCCCTGAGGGCTGGGAGCGCCCAATCTACCTCCA
GCCTATGGACGGCAAGGACGAAGCGGGCAACCGCGCGAACCTCGAGGCGTGCGTCGCGTC
GTGCATGTCCAAAGGCTACATCCTCCAGCTGCAAATCCACAAACTCATCGGAGCTGAA

<<attachment: Screenshot.png>>

_______________________________________________
Artemis-users mailing list
Artemis-users@sanger.ac.uk
http://lists.sanger.ac.uk/mailman/listinfo/artemis-users

Reply via email to