Tim, We commonly use multi-sequence GBK and GFF files. We know Artemis doesn't work with mult-GBK but it does work with GFF containing multiple source sequences (typically contigs) in the ##FASTA section. However, we are getting some GFF files that also have the translated protein sequences of each CDS feature in the ##FASTA section (much like CDS in GBK have /translation tags), like this:
*##gff-version 3* contig1 CDS ID=prot1 contig2 CDS ID=prot2 *##FASTA* >contig1 ATCTTAGATTCGAGTA >contig2 CTTAGATTCGAGTAAAATTAG >prot1 MVQWHGQ* >prot2 MVHGQQ* However, Artemis just treats the proteins as crazy DNA sequences and continues appending them to the list of source DNA sequences in the annotation. I'm pretty sure this is a valid GFF file (as /translation may contain wierd AAs they aren't the original codon etc). So how to handle it in Artemis? Only display ##FASTA entries that have column1 IDs in the feature table? Should I RTFM ? Thanks for any help, -- *--Dr Torsten Seemann --Scientific Director : Victorian Bioinformatics Consortium, Monash University, AUSTRALIA* *--Senior Researcher : VLSCI Life Sciences Computation Centre, Parkville, AUSTRALIA --http://www.bioinformatics.net.au/*
_______________________________________________ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
