what does shift do in perl? cheers
Rob. > -----Original Message----- > From: Janek Schleicher [mailto:[EMAIL PROTECTED] > Sent: 23 June 2003 08:52 > To: [EMAIL PROTECTED] > Subject: Re: perl reg exp problem > > > Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: > > > I have a string that is a random sequence like the following:- > > > > ACGTCGTCGTCACACACACGCGTCTCTATACGCG > > > > I want to be able to parse the string, picking out any TATA > sequences, > > colour them in red and make a not of where ther lie in the sequence. > > > > Is this possible with perl? > > Yes, but you have to explain in what matter you want to colorize. > As output in a terminal window, as html/xml, as a picture, as a word > document ... . > > If you would have in a pseudo-xml with the tag <red>...</red>, > you would perhaps do it as: > > $string =~ s/(TATA)/<red>$1</red>/g; > > > Greetings, > Janek > > -- > To unsubscribe, e-mail: [EMAIL PROTECTED] > For additional commands, e-mail: [EMAIL PROTECTED] > -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
