> I'm having trouble counting the number of specific substrings
> within a
> string. I'm working on a bioinformatics coursework at the
> moment, so my
> string looks like this:
>
> $sequence = "caggaacttcccctcggaagaccatgta";
>
> I want to count the number of occurrences of each pair of
> letters, for example:
>
> Number of occurrences of "aa"
> Number of occurrences of "gt"
> Number of occurrences of "cc"
>
> This is how I'm counting the number of "cc" pairs at the
> moment ($cc is
> my counter variable):
>
> $cc++ while $sequence =~ /cc/gi;
>
> But this only matches the literal string "cc", so if, as it scans
> $sequence, it finds "cccc" it's only counting it once instead
> of three
> times.
>
> What pattern do I need to be looking for in the $sequence if
> I want to
> count *all* occurences of "cc" -- even if they overlap?
use strict;
my $sequence = "caggaacttcccctcggaagaccatgta";
my $cc;
while ( $sequence =~ /cc/gi ) {
print "$` $& $'\n";
++$cc;
pos $sequence = pos($sequence) - 1;
}
print $cc;
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
