On Wed, Jun 4, 2008 at 11:51 AM, Joseph Dhahbi, P.h.D. <[EMAIL PROTECTED]> wrote: > > Hi > > If the masked width is the total number of nucleotide positions that are > masked, then why the maskedwidth in 'all masks together:" is not equal to > the sum of maskedwidth of all 3 masks?
Hi, Joseph. The maskedwidth is the sum of the number of nucleotide positions covered by the selected masks. If a base is included in more than one mask, it is counted only once. Sean >> chr2L=Dmelanogaster$chr2L >> chr2L > > 23011544-letter "MaskedDNAString" instance (# for masking) > seq: > CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATAT...CAATCAAACTGTGTTCGAAAAAGAGAAAACTAACATTTTTTTGGCATATTTGCAAATTTTGATGAACCCCCCTTTCAAA > masks: > maskedwidth maskedratio active names > 1 200 8.691290e-06 FALSE assembly gaps > 2 1966561 8.545976e-02 FALSE RepeatMasker > 3 61603 2.677048e-03 FALSE Tandem Repeats Finder [period<=12] > all masks together: > maskedwidth maskedratio > 1988181 0.08639929 > all active masks together: > maskedwidth maskedratio > 0 0 > > >> sum(200, 1966561, 61603) > > [1] 2028364 _______________________________________________ Bioc-sig-sequencing mailing list [email protected] https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
