I just checked in a trimLRPatterns function to the Bioconductor svn
repository for BioC 2.4. Its signature is
trimLRPatterns(Lpattern = NULL, Rpattern = NULL, subject,
max.Lmismatch = 0, max.Rmismatch = 0,
with.Lindels = FALSE, with.Rindels = FALSE,
Lfixed = TRUE, Rfixed = TRUE, ranges = FALSE)
As you can infer from the arguments, this function allows the user to
set the # of mismatches (if with.*indels = FALSE) / edit distance (if
with.*indels = TRUE) for the left and right flanking "patterns". It also
allows for IUPAC ambiguity letters in these flanking regions if *fixed =
FALSE. When ranges = FALSE, trimLRPatterns returns the trimmed strings.
When ranges = TRUE, it returns the ranges that you can use to trim the
strings. Here are some examples:
> Lpattern <- "TTCTGCTTG"
> Rpattern <- "GATCGGAAG"
> subject <- DNAString("TTCTGCTTGACGTGATCGGA")
> subjectSet <- DNAStringSet(c("TGCTTGACGGCAGATCGG",
"TTCTGCTTGGATCGGAAG"))
> trimLRPatterns(Lpattern = Lpattern, subject = subject)
11-letter "DNAString" instance
seq: ACGTGATCGGA
> trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject =
subjectSet)
A DNAStringSet instance of length 2
width seq
[1] 18 TGCTTGACGGCAGATCGG
[2] 0
> trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject =
subjectSet,
+ ranges = TRUE)
IRanges object:
start end width
1 1 18 18
2 10 9 0
This functionality will be available on bioconductor.org (and
downloadable via biocLite) in the next day or so, but you can also grab
Biostrings from svn directly if you need it sooner. It will also feed
its way into Biostrings documentation and training material before the
next release of Bioconductor in May.
Patrick
Patrick Aboyoun wrote:
David,
Following up on Martin's comments, I am putting the finishing touches
on a function called trimLRPatterns for the Biostrings package. Its
purpose is to trim left and/or right flanking patterns from sequences,
so it can strip 5' and/or 3' adapters from your reads. The signature
for this function is
trimLRPatterns(Lpattern=NULL, Rpattern=NULL, subject, max.Lnedit=0,
max.Rnedit=0,
with.Lindels=FALSE, with.Rindels=FALSE, Lfixed=TRUE,
Rfixed=TRUE,
rangesOnly = FALSE)
I will be checking this function into the BioC 2.4 code line, which
requires using R-devel, sometime today or tomorrow. I will send out an
e-mail to this group when I check it in and show a simple example of
its usage. I talked with Martin and he will wrap this functionality in
the ShortRead layer so you don't have to leave the ShortRead class
system when removing adapters from your reads.
Cheers,
Patrick
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
