Joern,
The aligned method for PairwiseAlignedFixedSubject objects extracts an
XStringSet containing the alignments in the "coordinate system" of the
fixed subject; i.e. the first position represents the first position
of the fixed subject, the second position represents the second
position of the fixed subject, etc. This means aligned will contain
matched/mismatched characters and deletions, but it will not tell you
about insertions. I'll make the man page more clear to avoid confusion
in the future.
suppressMessages(library(Biostrings))
subject <- DNAString("AAAACCCCGGGGTTTT")
pattern <- pattern <- DNAStringSet(c("left" = "ACGTACGTAAAA",
"deletions" = "AAAAGGGGTTTT", "insertions" = "AAAAAACCCCCCGGGGTTTT",
"right" = "TTTTACGT"))
pa <- pairwiseAlignment(pattern, subject, type = "global-local")
alignedPA <- aligned(pa)
names(alignedPA) <- names(pattern)
alignedPA
A DNAStringSet instance of length 4
width seq names
[1] 16 AAAA------------ left
[2] 16 AAAA----GGGGTTTT deletions
[3] 16 AAAACCCCGGGGTTTT insertions
[4] 16 ------------TTTT right
sessionInfo()
R version 2.10.0 Under development (unstable) (2009-05-08 r48504)
i386-apple-darwin9.6.0
locale:
[1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
attached base packages:
[1] stats graphics grDevices utils datasets methods base
other attached packages:
[1] Biostrings_2.13.9 IRanges_1.3.16
loaded via a namespace (and not attached):
[1] Biobase_2.5.2
Quoting Joern Toedling <[email protected]>:
Hello,
I believe there is a minor bug in the visualization provided by the "aligned"
method of the class "PairwiseAlignedFixedSubject".
I performed a pairwise alignment looking for overlaps between reads and a
fixed subject DNAString. Here are 10 reads which all show some form overlap
with the subject.
aligned(pa)
A DNAStringSet instance of length 10
width seq
[1] 37 CTTTAGGCACCAT------------------------
[2] 37 CTGTAGTCACCATC-----------------------
[3] 37 CTGTAGGCACCATC-----------------------
[4] 37 CTGTAGGCACCATC-----------------------
[5] 37 CTGTAGGCACCATCAAT--------------------
[6] 37 CTTTAGTCAACATC-----------------------
[7] 37 CTGTAGG------------------------------
[8] 37 CTGTAGGCACCATCAATCGT-----------------
[9] 37 --------------------------------GCTTT
[10] 37 CTGTATTCACCATCAA---------------------
start(pattern(pa))
[1] 24 23 23 23 20 23 30 17 1 21
end(pattern(pa))
[1] 36 36 36 36 36 36 36 36 5 36
So in fact for 9 of the 10 reads the overlap is at the end of the read, and
for one at the start. However, the visualization of the "aligned" method
wrongly suggest that it is the other way round.
Regards,
Joern
sessionInfo()
R version 2.10.0 Under development (unstable) (2009-05-18 r48561)
i686-pc-linux-gnu
attached base packages:
[1] stats graphics grDevices datasets utils methods base
other attached packages:
[1] ShortRead_1.3.5 lattice_0.17-25 BSgenome_1.13.2 Biostrings_2.13.9
[5] IRanges_1.3.16
loaded via a namespace (and not attached):
[1] Biobase_2.5.2 grid_2.10.0 hwriter_1.1
---
Joern Toedling
Institut Curie -- UMR218
26 rue d'Ulm, 75005 Paris, FRANCE
Tel. +33 (0)156246942
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
