Hi Jo -- On 02/04/2010 10:20 PM, Johannes Rainer wrote: > dear all, > > this is probably a very simple question but i'm quite new to the high > throughput sequencing... > I've got reads from an ChIPseq experiment and the service provider sent me > finally also the list of adaptors and primers for which i want to screen and > clip the reads (using the trimLRPatterns function from the ShortRead package > ). > > my question now is if I have to reverse complement the sequences also, and > if I should use e.g. the DNA_AD1 as the Lpattern parameter and the DNA_AD2 > as the Rpattern, or how does this work now? below I pasted some of the > adaptor/primer sequences.
Not a direct answer to your question, but ... (a) Solexa reads are reported as read from the flow cell, 5' to 3'; I think this means that no reverse complement is necessary. (b) I think it's relatively unusual to trim or filter ChIP-seq Solexa reads -- at least in shorter reads trimming would mean that there wasn't enough sequence for alignment, and not trimming would mean that the sequence is too dissimilar for alignment in the first place. Either way you end up with adapter sequences not aligning, and hence being discarded from any downstream analysis. Trimming adapters might become important in other scenarios, e.g., miRNA where the target is shorter than the read, or working with longer reads where sample prep introduces artifacts to be removed (e.g., primers or bar codes in metagenomic analysis of 454 reads). Martin > sorry for my newbie-question, > > bests, jo > > >> DNA_AD1 > GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG >> DNA_AD2 > ACACTCTTTCCCTACACGACGCTCTTCCGATCT >> DNA_PCR1 > AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCT >> DNA_PCR2 > CAAGCAGAAGACGGCATACGACGCTCTTCCGATCT >> DNA_SEQ > CACTCTTTCCCTACACGACGCTCTTCCGATCT >> GEXD_AD11 > GATCGTCGGACTGTAGAACTCTGAAC >> GEXD_AD12 > ACAGGTTCAGAGTTCTACAGTCCGAC >> GEXD_AD21 > ... > > -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793 _______________________________________________ Bioc-sig-sequencing mailing list [email protected] https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
