Hi, On Thu, Apr 29, 2010 at 4:11 AM, Dario Strbenac <[email protected]> wrote: > Hello, > > I was looking at the first few sequences in the readAligned object > > e.g. > >> head(sread(aligned)) > A DNAStringSet instance of length 6 > width seq > [1] 36 AACCCTAACCCTAACCCTAACCTTAACCTAACCTTA > [2] 36 TCCGCCTTCAGAGTACCACCGAAATCTGTGCAGAGG > [3] 36 GCCTCTCTGCGCCTGCGCCGGCGGCGTTTCGTTCTC > [4] 36 GCGCGGCGCGCCTCTCGGCGCCTGCGCCGGCGGAGG > [5] 36 GAGGAAAAAGGCAGGACAGAATTACGAGGTGCTGGC > [6] 36 GAAAAAGGCAGGACAGAATTACGAGATGCTGGCNCA > > and I looked at their strands > >> head(strand(aligned)) > [1] + + - - + + > > When I did a search in the .map file relating to this alignment, I was able > to find the first 2 sequences (which are on the + strand), but not the 3rd, > nor its complement. Same for the 4th which is also - strand. To get a > complement I used Biostrings::complementSeq.
Shouldn't you rather be checking for its reverseComplement? -- Steve Lianoglou Graduate Student: Computational Systems Biology | Memorial Sloan-Kettering Cancer Center | Weill Medical College of Cornell University Contact Info: http://cbio.mskcc.org/~lianos/contact _______________________________________________ Bioc-sig-sequencing mailing list [email protected] https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
