On 05/05/2010 02:35 PM, Martin Morgan wrote:
> On 05/05/2010 02:09 PM, Hervé Pagès wrote:
>> Hans-Ulrich Klein wrote:
>>> Hi,
>>>
>>> I have have the same problem. I want to write ~ 4Mio small (25bps)
>>> sequences into one fasta file. write.XStringSet() is very slow. Also,
>>> writeFASTA() is very low. Only about 1500 sequences are written per
>>> minute.
>
> if 'dna' is a DNAStringSet with names, and for this case where reaads
> are < 80 characters, then maybe
>
> fasta = paste(paste(">", names(dna), sep=""),
> as.character(dna), sep="\n", collapse="\n")
> fl = tempfile()
> writeLines(fasta, fl)
or probably better
fasta = character(2 * length(dna))
fasta[c(TRUE, FALSE)] = paste(">", names(dna), sep="")
fasta[c(FALSE, TRUE)] = as.character(dna)
writeLines(fasta, fl)
Martin
>
> Martin
>
>>
>> OK, I guess it's time to bite the bullet as they say.
>>
>> It has been on my TODO list for a long time to implement
>> write.XStringSet() in C so I will work on this and let you
>> know when it's ready.
>>
>> Cheers,
>> H.
>>
>>>
>>> Are there any alternatives?
>>>
>>> Best wishes,
>>> Hans-Ulrich
>>>
>>>
>>> > sessionInfo()
>>> R version 2.11.0 RC (2010-04-19 r51778)
>>> x86_64-pc-linux-gnu
>>>
>>> locale:
>>> [1] C
>>>
>>> attached base packages:
>>> [1] stats graphics grDevices utils datasets methods base
>>>
>>> other attached packages:
>>> [1] ShortRead_1.6.2 Rsamtools_1.0.1 lattice_0.18-5
>>> [4] Biostrings_2.16.0 GenomicRanges_1.0.1 IRanges_1.6.0
>>>
>>> loaded via a namespace (and not attached):
>>> [1] Biobase_2.8.0 grid_2.11.0 hwriter_1.2 tools_2.11.0
>>>
>>>
>>>
>>>
>>>
>>> Steffen Neumann wrote:
>>>> Hi,
>>>>
>>>> I have some major performance problems writing fasta files
>>>> with Biostrings. I have the full Arabidopsis Chr1 (30MByte) in one
>>>> DNAString,
>>>> and writing that to a file takes ages, as you see from the strace output
>>>> below: I obtain ~5 lines (80 chars each) per second. The runtime
>>>> of the system call<in brackets> is neglectible.
>>>>
>>>> library(Biostrings)
>>>> chromosome<-read.DNAStringSet("Chr1_TAIR9.fasta", "fasta")
>>>> write.XStringSet(chromosome, file="/tmp/test.fasta", format="fasta")
>>>>
>>>> Is there a fundamental flaw in my thinking ?
>>>> Is there an alternative to write.XStringSet() ?
>>>> This happens both on my laptop and a beefy server.
>>>>
>>>> I also tried the (ancient) IRanges_1.0.16 and Biostrings_2.10.22,
>>>> and get ~11 lines per second.
>>>>
>>>> Yours,
>>>> Steffen
>>>>
>>>> 13:06:09.949290 write(4, "TAGGAGTTGATGAAGACATCTAACGAAAATTC"..., 80) =
>>>> 80<0.000137>
>>>> 13:06:10.138835 write(4, "GTGCTCAGGCTTCATTGATAAGGAAAGAAACA"..., 80) =
>>>> 80<0.000142>
>>>> 13:06:10.328395 write(4, "AAAGCAGAAACCGACGTGAAATATTACAGAGA"..., 80) =
>>>> 80<0.000133>
>>>> 13:06:10.537475 write(4, "AGACTACTCGAGAATCATTGCACTGAAGAAAG"..., 80) =
>>>> 80<0.000159>
>>>> 13:06:10.727281 write(4, "AAGTGAAAAGAGAAAGAGAATGTGTGATGTGT"..., 80) =
>>>> 80<0.000133>
>>>> 13:06:10.916854 write(4, "CTTTGCTTTAAATGCAATCAGCTTCACGAGAA"..., 80) =
>>>> 80<0.000136>
>>>> 13:06:11.105687 write(4, "GATTCAAGCTCGTTTCGCTCGCTCCGGGTGAA"..., 80) =
>>>> 80<0.000594>
>>>>
>>>> sessionInfo()
>>>> R version 2.10.0 (2009-10-26)
>>>> x86_64-unknown-linux-gnu
>>>>
>>>> locale:
>>>> [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
>>>> [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
>>>> [5] LC_MONETARY=C LC_MESSAGES=en_US.UTF-8
>>>> [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
>>>> [9] LC_ADDRESS=C LC_TELEPHONE=C
>>>> [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
>>>>
>>>> attached base packages:
>>>> [1] stats graphics grDevices utils datasets methods base
>>>>
>>>> other attached packages:
>>>> [1] Biostrings_2.14.12 IRanges_1.4.16
>>>>
>>>> loaded via a namespace (and not attached):
>>>> [1] Biobase_2.6.0
>>>>
>>>>
>>>
>>>
>>
>
>
--
Martin Morgan
Computational Biology / Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N.
PO Box 19024 Seattle, WA 98109
Location: Arnold Building M1 B861
Phone: (206) 667-2793
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing