On 11/05/2010 08:51 AM, Kunbin Qu wrote:
> Dear all,
> 
> can readAligned() or other function read in the reads mapped across
> the junctions in the "export" file (eg, s_1_export.txt)  from
> Illumina's pipeline? The following is the example of a regular
> mapping entry and a read mapped across two exons. I had a test file
> named s1Test, and when I used the following command, it can only read
> in the first read. Thanks.

It's tricky to know what your file looks like, but this should be parsed
by readAligned.

> x = readAligned("/tmp/kunbin_export.txt", type="SolexaExport")
> x
class: AlignedRead
length: 2 reads; width: 51 cycles
chromosome: chrX.fa
splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824
position: 108773654 20
strand: + -
alignQuality: NumericQuality
alignData varLabels: run lane ... filtering contig
> sread(x)
  A DNAStringSet instance of length 2
    width seq
[1]    51 NTTTTAAAAACAGAATTTCTGCTCTATAATAACACAGCTAAAGGGAAATAA
[2]    51 NGAACTTTAAGAGTGGTGTGGATGCAGACTCTTCTTATTTTAAAATCTTTA
> quality(x)
class: SFastqQuality
quality:
  A BStringSet instance of length 2
    width seq
[1]    51 BKOJHRQPPO_QQ_____b_b___b_bb_bb__bb__b_b___bbb_b__Q
[2]    51 BKIKKUUTTU_____[[[[[[[[[[_b_____b______QQQ__b___b__

maybe your 'cfilt' filters out 'chromosomes' (which should probably have
been something else, rseq?)

> chromosome(x)
[1] chrX.fa
[2] splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824
2 Levels: chrX.fa ...

More hints on what 'it can only read the first read' means might help.

Martin


> 
> -Kunbin
> 
> SEQUENCER01     10      1       1       5110    943     0       1
> NTTTTAAAAACAGAATTTCTGCTCTATAATAACACAGCTAAAGGGAAATAA
> BKOJHRQPPO_QQ_____b_b___b_bb_bb__bb__b_b___bbb_b__Q     chrX.fa
> 108773654    F       T50     199
> Y
> 
> SEQUENCER01     10      1       1       2815    941     0       1
> NGAACTTTAAGAGTGGTGTGGATGCAGACTCTTCTTATTTTAAAATCTTTA
> BKIKKUUTTU_____[[[[[[[[[[_b_____b______QQQ__b___b__
> splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824   20
> R       A50     200                                 Y
> 
> 
> 
> 
>> s1t<-readAligned("./", pattern="s1Test", type="SolexaExport",
>> filter=cfil) sessionInfo()
> R version 2.11.0 (2010-04-22) x86_64-unknown-linux-gnu
> 
> locale: [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C [3]
> LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8 [5] LC_MONETARY=C
> LC_MESSAGES=en_US.UTF-8 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C [9]
> LC_ADDRESS=C               LC_TELEPHONE=C [11]
> LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
> 
> attached base packages: [1] stats     graphics  grDevices utils
> datasets  methods   base
> 
> other attached packages: [1] ShortRead_1.6.2     Rsamtools_1.0.1
> lattice_0.19-11 [4] Biostrings_2.16.7   GenomicRanges_1.0.1
> IRanges_1.6.8
> 
> loaded via a namespace (and not attached): [1] Biobase_2.8.0
> grid_2.11.0   hwriter_1.2   tools_2.11.0
>> 
> 
> 
> 
> ______________________________________________________________________
>
> 
The contents of this electronic message, including any attachments, are
intended only for the use of the individual or entity to which they are
addressed and may contain confidential information. If you are not the
intended recipient, you are hereby notified that any use, dissemination,
distribution, or copying of this message or any attachment is strictly
prohibited. If you have received this transmission in error, please send
an e-mail to [email protected] and delete this message, along
with any attachments, from your computer.
> [[alternative HTML version deleted]]
> 
> _______________________________________________ Bioc-sig-sequencing
> mailing list [email protected] 
> https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing


-- 
Computational Biology
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109

Location: M1-B861
Telephone: 206 667-2793

_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing

Reply via email to