You are correct. Your setting of 'ranges' is being ignored by the
ShortRead
method, as we clearly see from
showMethods("trimLRPatterns", includeDefs=TRUE)
It sounds like a bug to me unless there is documentation for it,
which I don't
find, but maybe I don't know where to look.
The workaround for you right now, to get an IRanges value, would be
to send
trimLRPatterns the sread slot of your ShortRead object, as in
trimLRPatterns(subject=sread(your_ShortRead_object), ranges=T, other
params)
But perhaps Martin knows better.
-Harris
On Dec 3, 2010, at 10:16 AM, Lionel (Lee) Brooks 3rd wrote:
Hello all,
I am using trimLRPatterns to trim adapter sequences from my short
read fastq file. I followed the excellent tutorial at UCRiverside
and everything works swimmingly. My issue is that I do not
understand the distinction between objects created with
trimLRPatterns(...,ranges=TRUE) and those created with
trimLRPatterns(...,ranges=FALSE).
I create my ShortRead object in the following manner:
reads <- readFastq("/path/to/seqandqualities.fastq")
seqs <- sread(reads) # get sequence list
qual <- quality(reads) # get quality score list
qual <- quality(qual) # strip quality score type
adapter3pr <- "TCGTATGCCGTCTTCTGCTTG"
adapter5pr <- "CGACAGGTTCAGAGTTCTACAGTCCGACGATC"
# This is the adapter sequence to be trimmed from the ends of
your reads
trimCoords <- trimLRPatterns(Rpattern=adapter3pr,
Lpattern=adapter5pr, subject=seqs, ranges=T)
# Trim sequences looking for a right end and left end pattern
# Gets IRanges object with trimmed coordinates
seqs <- DNAStringSet(seqs, start=start(trimCoords), end=end
(trimCoords))
qual <- BStringSet(qual, start=start(trimCoords), end=end(trimCoords))
# Use IRanges coordinates to trim sequences and quality scores
qual <- SFastqQuality(qual) # reapply quality score type
trimmed <- ShortReadQ(sread=seqs, quality=qual, id=id(reads))
Now...my confusion arose when I used the same code EXCEPT I used
ranges=F in the trimLRPatterns call. Like this:
trimCoords <- trimLRPatterns(Rpattern=adapter3pr,
Lpattern=adapter5pr, subject=seqs, ranges=F)
but upon examing the resulting object:
atrributes(trimCoords)
I can see no difference between the object that I created when
ranges=T. Can anyone tell me what is happening here? I wish to
extract the match coordinates from the trimCoords object.
Please Note I adapted this code from:
http://manuals.bioinformatics.ucr.edu/home/ht-seq#TOC-SmallRNA-
Profiling
Appreciatively,
Lee Brooks
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing