Hi Andreas, thanks for the feedback.
increasing gop and gep was not sufficient. I had to use a modified version of nuc-4_2 scoring matrix where I set the mismatch value very low. This solved the problem, Best khalil ----- Confidentiality Notice: This e-mail and any files transmitted with it are private and confidential and are solely for the use of the addressee. It may contain material which is legally privileged. If you are not the addressee or the person responsible for delivering to the addressee, please notify that you have received this e-mail in error and that any use of it is strictly prohibited. It would be helpful if you could notify the author by replying to it. On 11 Jun 2013, at 18:00, [email protected] wrote: > Send Biojava-l mailing list submissions to > [email protected] > > To subscribe or unsubscribe via the World Wide Web, visit > http://lists.open-bio.org/mailman/listinfo/biojava-l > or, via email, send a message with subject or body 'help' to > [email protected] > > You can reach the person managing the list at > [email protected] > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Biojava-l digest..." > > > Today's Topics: > > 1. Re: Local aln - contig assembly (Andreas Prlic) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Mon, 10 Jun 2013 17:47:41 -0700 > From: Andreas Prlic <[email protected]> > Subject: Re: [Biojava-l] Local aln - contig assembly > To: Khalil El Mazouari <[email protected]> > Cc: "[email protected]" <[email protected]> > Message-ID: > <CALthepyva-+rAoP=8yH=omdea1s7i9ov4js5eayk-bl4r1x...@mail.gmail.com> > Content-Type: text/plain; charset=ISO-8859-1 > > Hi Khalil, > > if you can get 100% sequence ID depends on your sequences.. you can try to > enforce a more strict alignment by increasing the gap penalties > significantly (try to double or triple gap opening and extension) . > > A > > > On Sun, Jun 9, 2013 at 12:32 PM, Khalil El Mazouari < > [email protected]> wrote: > >> Hi, >> >> I am trying to assemble overlapping sequence (direct & reverse) via local >> alignment. I am only searching for local aln with 100% identity. >> >> Which parameters, matrix ... should I use in order to get 100% ident. >> local aln. >> >> Any other suggestion for assembling overlapping seq (in Java) is welcome. >> >> Thanks >> >> khalil >> >> >> >> SubstitutionMatrix<NucleotideCompound> matrix = >> SubstitutionMatrixHelper.getNuc4_2(); >> SimpleGapPenalty gapP = new SimpleGapPenalty(); >> gapP.setOpenPenalty((short) 5); >> gapP.setExtensionPenalty((short) 1); >> SequencePair<DNASequence, NucleotideCompound> psa = >> Alignments.getPairwiseAlignment(query, target, >> PairwiseSequenceAlignerType.LOCAL, gapP, matrix); >> >> >> >> >> ======== >> >> Local Alignment Identity: 97.84688995215312% >> >> query GGGGAAAACACGAAAGGCCCTTGGTGGAGGCGCTTGAGACGGTGACAAGGGTTCCCTGGC 68 >> |||||| || ||| ||||||||||||||||||||||||||||||| ||||||||||||| >> target GGGGAAGAC-CGATGGGCCCTTGGTGGAGGCGCTTGAGACGGTGACCAGGGTTCCCTGGC 417 >> >> query CCCAGTAGTCAAAGGTCCGTGAGGAGCTCCACTTGTGTGCACAGTAATATGTGGCTGAGT 128 >> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >> target CCCAGTAGTCAAAGGTCCGTGAGGAGCTCCACTTGTGTGCACAGTAATATGTGGCTGAGT 477 >> >> query CCACAGGGTCCATGTTGGTCATTGTAAGGACCACCTGGTCTTTGGAGGTGTCCTTGGTGA 188 >> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >> target CCACAGGGTCCATGTTGGTCATTGTAAGGACCACCTGGTCTTTGGAGGTGTCCTTGGTGA 537 >> >> query TGGTGAGCCTGCTCTTCAGAGATGGGCTGTAGCGCTTATCATCATTCCAATAAATGAGTG 248 >> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >> target TGGTGAGCCTGCTCTTCAGAGATGGGCTGTAGCGCTTATCATCATTCCAATAAATGAGTG 597 >> >> query CAAGCCACTCCAGGGCCTTTCCTGGGGGCTGACGGATCCAGCCCACACCCACTCCACTAG 308 >> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >> target CAAGCCACTCCAGGGCCTTTCCTGGGGGCTGACGGATCCAGCCCACACCCACTCCACTAG 657 >> >> query TGCTGAGTGAGAACCCAGAGAAGGTGCAGGTCAGCGTGAGGGTCTGTGTGGGTTTCACCA 368 >> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >> target TGCTGAGTGAGAACCCAGAGAAGGTGCAGGTCAGCGTGAGGGTCTGTGTGGGTTTCACCA 717 >> >> query GCGTAGGACCAGACTCCTTCAAGGTGATCTGGGCCATGGCCGGCTGGGCCGCGAGTAA 426 >> |||||||||||||||||||||||||| ||||||||| |||||||||| |||| ||||| >> target GCGTAGGACCAGACTCCTTCAAGGTG-TCTGGGCCA-GGCCGGCTGG-CCGCAAGTAA 772 >> >> >> >> >> >> >> >> >> >> >> ----- >> >> Confidentiality Notice: This e-mail and any files transmitted with it are >> private and confidential and are solely for the use of the addressee. It >> may contain material which is legally privileged. If you are not the >> addressee or the person responsible for delivering to the addressee, please >> notify that you have received this e-mail in error and that any use of it >> is strictly prohibited. It would be helpful if you could notify the author >> by replying to it. >> >> >> >> >> _______________________________________________ >> Biojava-l mailing list - [email protected] >> http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > ------------------------------ > > _______________________________________________ > Biojava-l mailing list - [email protected] > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > End of Biojava-l Digest, Vol 125, Issue 2 > ***************************************** _______________________________________________ Biojava-l mailing list - [email protected] http://lists.open-bio.org/mailman/listinfo/biojava-l
