Hello all,
I just would like to say castor is really cool, thanks for all your hard
work. I am trying to map some xml formats from DAS servers to object in my
program...
Okay first off my xml document:
<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASDNA SYSTEM "http://www.biodas.org/dtd/dasdna.dtd";>
<DASDNA>
<SEQUENCE id="id" start="start" stop="stop" version="X.XX">
<DNA length="NNNN">
atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa
taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa
</DNA>
</SEQUENCE>
</DASDNA>
Okay so this is my xml, now I need to convert this into a DNA object ...
the DNA object looks like this:
public class DNA implements Sequence
{
private String id;
private Range range;
private long length;
private String version;
private String value;
private String type;
public String getID() ...
...
}
My mapping:
<mapping>
<class name="edu.mit.wi.omnigene.omnidas.DASDNA">
<map-to xml="DASDNA"/>
<field name="DNAs"
type="edu.mit.wi.omnigene.omnidas.DNA" collection="array">
<bind-xml name="SEQUENCE"/>
</field>
</class>
<class name="edu.mit.wi.omnigene.omnidas.DNA">
<map-to xml="SEQUENCE"/>
<!-- XXX
How do I deal with this?
making a range object from two
attributes in the SEQUENCE tag, how? impossible?
<field name="Range" type="edu.mit.wi.omnigene.omnidas.RangeImpl">
<bind-xml name="stop" node="attribute"/>
</field>
<field name="Range" type="edu.mit.wi.omnigene.omnidas.RangeImpl">
<bind-xml name="start" node="attribute"/>
</field> -->
<field name="ID" type="java.lang.String">
<bind-xml name="id" node="attribute"/>
</field>
<!-- XXX This needs to be in the DNA element to get this
attribute, dang, any ideas?
<field name="Length" type="long">
<bind-xml name="length" node="attribute"/>
</field>
-->
<field name="SequenceValue" type="java.lang.String" >
<bind-xml name="DNA" node="element"/>
</field>
</class>
</mapping>
the DNA class is mapped to the SEQUENCE tag. Now if I already mapped
the SEQUENCE tag to a DNA object, can i map it to a Range object as well
so I can access the start and stop attributes? Also is there a way to
access the length attribute of the DNA tag?
Thanks in advance,
Mike Stoppelman
omnigene.sourceforge.net
-----------------------------------------------------------
If you wish to unsubscribe from this mailing, send mail to
[EMAIL PROTECTED] with a subject of:
unsubscribe castor-dev
