Dear ALL;
As an alternative strategy to avoid endotoxin, I plan to express the
protein in mammalian cells.
As suggested by others, the typical vector is pcDNA3.1(+). Does anyone
have comments on this vector or recommend some other powerful vectors?
I am new to mammalian expression. I designed a Kozak sequence followed by
a BSA signal peptide in order to clone the target into pcDNA3.1(+).
Is it right? Tentative Kozak sequence:
GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCTTTTCT
Thanks a lot,
Jerry
