This distribution has been tested as part of the cpan-testers effort to test as many new uploads to CPAN as possible. See http://testers.cpan.org/
Please cc any replies to [email protected] to keep other test volunteers informed and to prevent any duplicate effort. -- Dear Ewan Birney, This is a computer-generated test report for bioperl-1.4, created automatically by CPAN::Reporter, version 0.99_08, and sent to the CPAN Testers mailing list. If you have received this email directly, it is because the person testing your distribution chose to send a copy to your CPAN email address; there may be a delay before the official report is received and processed by CPAN Testers. Thank you for uploading your work to CPAN. However, it appears that there were some problems testing your distribution. Sections of this report: * Tester comments * Prerequisites * Environment and other context * Test output ------------------------------ TESTER COMMENTS ------------------------------ Additional comments from tester: [none provided] ------------------------------ PREREQUISITES ------------------------------ Prerequisite modules loaded: requires: Module Need Have -------------- ---- ----- DB_File 0 1.815 File::Spec 0 3.25 File::Temp 0 0.18 HTML::Entities 0 1.35 IO::Scalar 0 2.110 IO::String 0 1.08 ------------------------------ ENVIRONMENT AND OTHER CONTEXT ------------------------------ Environment variables: LANG = C PATH = /usr/lib/ccache:/home/sand/bin:/usr/local/bin:/usr/bin:/bin:/usr/bin/X11:/usr/games:/usr/local/perl/bin:/usr/X11/bin:/sbin:/usr/sbin PERL5LIB = PERL5_CPANPLUS_IS_RUNNING = 445 PERL5_CPAN_IS_RUNNING = 445 PERL_MM_USE_DEFAULT = 1 SHELL = /usr/bin/zsh TERM = screen Perl special variables (and OS-specific diagnostics, for MSWin32): Perl: $^X = /home/src/perl/repoperls/installed-perls/maint-5.8/pFrR8O4/[EMAIL PROTECTED]/bin/perl UID: $< = 1005 EUID: $> = 1005 GID: $( = 1005 1005 EGID: $) = 1005 1005 Perl module toolchain versions installed: Module Have ------------------- ------- CPAN 1.9101 Cwd 3.25 ExtUtils::CBuilder 0.19 ExtUtils::Command 1.13 ExtUtils::Install 1.44 ExtUtils::MakeMaker 6.36 ExtUtils::Manifest 1.51 ExtUtils::ParseXS 2.18 File::Spec 3.25 Module::Build 0.2808 Module::Signature 0.55 Test::Harness 2.99_02 Test::More 0.70 YAML 0.65 YAML::Syck 0.97 version 0.7203 ------------------------------ TEST OUTPUT ------------------------------ Output from '/usr/bin/make test': PERL_DL_NONLAZY=1 /home/src/perl/repoperls/installed-perls/maint-5.8/pFrR8O4/[EMAIL PROTECTED]/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/AAChange.....................ok t/AAReverseMutate..............ok t/AlignIO......................ok t/AlignStats...................ok t/Allele.......................ok t/Alphabet.....................ok t/Annotation...................ok t/AnnotationAdaptor............ok t/Assembly.....................ok t/Biblio.......................SOAP::Lite not installed. Skipping some tests. ok t/Biblio_biofetch..............ok t/BiblioReferences.............ok t/BioDBGFF.....................ok t/BioFetch_DB.................. Failed 1/27 subtests t/BioGraphics..................GD or Text::Shellwords modules are not installed. This means that Bio::Graphics module is unusable. Skipping tests. ok t/BlastIndex...................ok t/BPbl2seq.....................ok t/BPlite.......................ok t/BPpsilite....................ok t/Chain........................ok t/cigarstring..................ok t/ClusterIO....................ok t/Coalescent...................ok t/CodonTable...................ok t/consed.......................ok t/CoordinateGraph..............ok t/CoordinateMapper.............ok t/Correlate....................ok t/CytoMap......................ok t/DB...........................ok t/DBCUTG.......................ok t/DBFasta......................ok t/DNAMutation..................ok t/Domcut.......................ok t/ECnumber.....................ok t/ELM.......................... -------------------- WARNING --------------------- MSG: Bio::Tools::Analysis::Protein::ELM Request Error: 400 URL must be absolute Content-Type: text/plain Client-Date: Mon, 10 Sep 2007 14:41:20 GMT Client-Warning: Internal response 400 URL must be absolute --------------------------------------------------- ok t/EMBL_DB...................... Failed 3/15 subtests t/EMBOSS_Tools.................ok t/EncodedSeq...................ok t/ePCR.........................ok t/ESEfinder....................ok t/est2genome...................ok t/Exception....................ok t/Exonerate....................ok t/flat.........................ok t/FootPrinter..................ok t/game.........................ok t/GDB..........................ok t/GeneCoordinateMapper......... -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- Use of uninitialized value in concatenation (.) or string at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/Coordinate/GeneMapper.pm line 814. ok t/Geneid.......................ok t/Genewise.....................ok t/Genomewise...................ok t/Genpred......................ok t/GFF..........................Filehandle GEN0 opened only for output at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/Root/IO.pm line 440. Filehandle GEN1 opened only for output at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/Root/IO.pm line 440. ok t/GOR4.........................ok t/GOterm.......................ok t/GuessSeqFormat...............ok t/hmmer........................ok t/HNN..........................ok t/Index........................ok t/InstanceSite.................ok t/InterProParser...............ok t/IUPAC........................ok t/largefasta...................ok t/largepseq....................ok t/LinkageMap...................ok t/LiveSeq......................ok t/LocatableSeq.................ok t/Location.....................ok t/LocationFactory..............ok t/LocusLink....................ok t/lucy.........................ok t/Map..........................ok t/MapIO........................ok t/Matrix.......................ok t/Measure......................ok t/MeSH.........................Use of uninitialized value in substitution (s///) at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/DB/MeSH.pm line 263. Use of uninitialized value in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/Bio/DB/MeSH.pm line 277. Failed 1/26 subtests t/MetaSeq......................ok t/MicrosatelliteMarker.........ok t/MiniMIMentry.................ok t/MitoProt.....................ok t/Molphy.......................ok t/multiple_fasta...............ok t/Mutation.....................ok t/Mutator......................ok t/NetPhos......................ok t/Node.........................ok t/OddCodes.....................ok t/OMIMentry....................ok t/OMIMentryAllelicVariant......ok t/OMIMparser...................ok t/Ontology.....................set_attribute: not a compat02 graph at /home/src/perl/repoperls/installed-perls/maint-5.8/pFrR8O4/[EMAIL PROTECTED]/lib/site_perl/5.8.8/Graph.pm line 2393, <GEN0> line 10. Dubious, test returned 9 (wstat 2304, 0x900) Failed 50/50 subtests t/OntologyEngine...............ok t/PAML.........................ok t/Perl.........................ok t/phd..........................ok t/Phenotype....................ok t/PhylipDist...................ok t/pICalculator.................ok t/Pictogram....................ok t/PopGen.......................ok t/PopGenSims...................ok t/primaryqual..................ok t/PrimarySeq...................ok t/primedseq....................ok t/Primer.......................ok t/primer3......................ok t/Promoterwise.................ok t/ProtDist.....................ok t/psm..........................ok t/QRNA.........................ok t/qual.........................ok t/RandDistFunctions............ok t/RandomTreeFactory............ok t/Range........................ok t/RangeI.......................ok t/RefSeq.......................ok t/Registry.....................ok t/Relationship.................ok t/RelationshipType.............ok t/RemoteBlast..................ok t/RepeatMasker.................ok t/RestrictionAnalysis..........ok t/RestrictionEnzyme............ok t/RestrictionIO................ok t/RNAChange....................ok t/RootI........................ok t/RootIO.......................ok t/RootStorable.................ok t/Scansite.....................ok t/scf..........................ok t/SearchDist...................ok t/SearchIO.....................ok t/Seq..........................ok t/SeqAnalysisParser............ok t/SeqBuilder...................ok t/SeqDiff......................ok t/SeqFeatCollection............ok t/SeqFeature...................ok t/seqfeaturePrimer.............ok t/SeqIO........................ok t/SeqPattern...................ok t/SeqStats.....................ok t/SequenceFamily...............ok t/sequencetrace................ok t/SeqUtils.....................ok t/seqwithquality...............ok t/SeqWords.....................ok t/Sigcleave....................ok t/Sim4.........................ok t/SimilarityPair...............ok t/SimpleAlign..................ok t/simpleGOparser...............set_attribute: not a compat02 graph at /home/src/perl/repoperls/installed-perls/maint-5.8/pFrR8O4/[EMAIL PROTECTED]/lib/site_perl/5.8.8/Graph.pm line 2393, <GEN1> line 14. Dubious, test returned 9 (wstat 2304, 0x900) Failed 98/98 subtests t/sirna........................ok t/SiteMatrix...................ok t/SNP..........................ok t/Sopma........................ok t/Species......................ok t/splicedseq...................ok t/StandAloneBlast..............ok t/StructIO.....................ok t/Structure....................ok t/Swiss........................ok t/Symbol.......................ok t/Taxonomy.....................ok t/Tempfile.....................ok t/Term.........................ok t/Tools........................ok t/Tree.........................ok t/TreeIO.......................ok t/trim.........................ok t/tutorial.....................Use of uninitialized value in print at /home/sand/.cpan/build/bioperl-1.4-HcuFbL/blib/lib/bptutorial.pl line 4042, <GEN20> line 934. ok t/UCSCParsers..................ok t/Unflattener..................ok t/Unflattener2.................ok t/UniGene......................ok t/Variation_IO.................1d0 < 32d30 < 60d57 < 91d87 < 121d116 < 152d146 < 183d176 < 214d206 < 245d236 < 268d258 < 291d280 < 315d303 < 347d334 < 379d365 < 1d0 < 1,350c1,388 < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+14T>A; L5X < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 14 < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature RNA; 1 < Feature /label: nonsense < Feature /proof: experimental < Feature /location: 14 (M20132::376) < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature /codon_table: 1 < Feature /codon: tta>taa; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: truncation < Feature /proof: computed < Feature /location: 5 < Feature /change: L>* < // < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+100delATCCAG; I34del-2 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 100..105 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature RNA; 1 < Feature /label: inframe, deletion < Feature /proof: experimental < Feature /location: 100..105 (M20132::462..467) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 34..35 < Feature /change: IQ> < // < ID M20132:(362)c.+101delT; I34delX172 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature RNA; 1 < Feature /label: frameshift, deletion < Feature /proof: experimental < Feature /location: 101 (M20132::463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAP < Feature GSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPAR < Feature GCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* < // < ID M20132:(362)c.+101insGGGCCC; I34ins+2 < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 100^101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature RNA; 1 < Feature /label: inframe, insertion < Feature /proof: experimental < Feature /location: 100^101 (M20132::462^463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: insertion, complex < Feature /proof: computed < Feature /location: 34 < Feature /change: I>RAL < // < ID M20132:(362)c.+100insG; I34ins81X < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 99^100 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature RNA; 1 < Feature /label: frameshift, insertion < Feature /proof: experimental < Feature /location: 99^100 (M20132::461^462) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362)c.+100AT>GGGCCC; I34ins82X < Feature DNA; 1 < Feature /label: complex < Feature /proof: computed < Feature /location: 100..101 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature RNA; 1 < Feature /label: frameshift, complex < Feature /proof: experimental < Feature /location: 100..101 (M20132::462..463) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362+1)c.-1G>A < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: -1 < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -1 (M20132::361) < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature /region: 5'UTR < // < ID M20132:(362)c.+2766T>C < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 2766 < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: 2766 (M20132::3128) < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature /region: 3'UTR < // < ID J02933:(521)g.+12165A>G < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: experimental < Feature /location: 12165 (J02933::12686) < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (+1027) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: computed < Feature /location: 2428 < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (-1) < // < ID J02933:(521)g.+4G>T; V2F < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 4 (J02933::525) < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /region: exon; 1 (+4) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /codon_table: 1 < Feature /codon: gtc>ttc; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 2 < Feature /change: V>F < // < ID J02933:(521)g.+1168G>T; D34Y < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 1168 (J02933::1689) < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /region: exon; 1 (-29) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 100 < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /codon_table: 1 < Feature /codon: gac>tac; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 34 < Feature /change: D>Y < // < ID J02933:(521+1)g.-4C>G < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: -4 (J02933::518) < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (-4) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -4 < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (+31) < // --- > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+4G>A" > trivname="E2K"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <restriction_changes>-BccI</restriction_changes> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <codon codon_ori="gaa" codon_mut="aaa" codon_pos="1"></codon> > <restriction_changes>-BccI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>conservative</label> > <proof>computed</proof> > <allele_ori>E</allele_ori> > <allele_mut>K</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+14T>A" > trivname="L5X"> > <DNA number="1" start="14" end="14" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>ccaagctcaaggatggaagtgcagt</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>agggctgggaagggtctaccctcgg</dnFlank> > </DNA> > <RNA number="1" start="14" end="14" length="1" isMutation="1"> > <label>nonsense</label> > <proof>experimental</proof> > <upFlank>ccaagctcaaggatggaagtgcagt</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>agggctgggaagggtctaccctcgg</dnFlank> > <codon codon_ori="tta" codon_mut="taa" codon_pos="2"></codon> > <region>coding</region> > </RNA> > <AA number="1" start="5" end="5" length="1" isMutation="1"> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>L</allele_ori> > <allele_mut>*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+4G>A" > trivname="E2K"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <restriction_changes>-BccI</restriction_changes> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <codon codon_ori="gaa" codon_mut="aaa" codon_pos="1"></codon> > <restriction_changes>-BccI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>conservative</label> > <proof>computed</proof> > <allele_ori>E</allele_ori> > <allele_mut>K</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100delATCCAG" > trivname="I34del-2"> > <DNA number="1" start="100" end="105" length="6" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>atccag</allele_ori> > <allele_mut></allele_mut> > <dnFlank>aacccgggccccaggcacccagagg</dnFlank> > <restriction_changes>-BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, > +MjaIV</restriction_changes> > </DNA> > <RNA number="1" start="100" end="105" length="6" isMutation="1"> > <label>inframe</label> > <label>deletion</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>atccag</allele_ori> > <allele_mut></allele_mut> > <dnFlank>aacccgggccccaggcacccagagg</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>-BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, > +MjaIV</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="35" length="2" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <allele_ori>IQ</allele_ori> > <allele_mut></allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+101delT" > trivname="I34delX172"> > <DNA number="1" start="101" end="101" length="1" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori>t</allele_ori> > <allele_mut></allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <restriction_changes>-BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, > +Tsp45I</restriction_changes> > </DNA> > <RNA number="1" start="101" end="101" length="1" isMutation="1"> > <label>frameshift</label> > <label>deletion</label> > <proof>experimental</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori>t</allele_ori> > <allele_mut></allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <codon codon_ori="atc" codon_pos="2"></codon> > <restriction_changes>-BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, > +Tsp45I</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+101insGGGCCC" > trivname="I34ins+2"> > <DNA number="1" start="101" end="101" length="0" isMutation="1"> > <label>insertion</label> > <proof>computed</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori></allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>tccagaacccgggccccaggcaccc</dnFlank> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, > +SduI</restriction_changes> > </DNA> > <RNA number="1" start="101" end="101" length="0" isMutation="1"> > <label>inframe</label> > <label>insertion</label> > <proof>experimental</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori></allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>tccagaacccgggccccaggcaccc</dnFlank> > <codon codon_ori="atc" codon_pos="2"></codon> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, > +SduI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>insertion</label> > <label>complex</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > <allele_mut>RAL</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100insG" > trivname="I34ins81X"> > <DNA number="1" start="100" end="100" length="0" isMutation="1"> > <label>insertion</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori></allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atccagaacccgggccccaggcacc</dnFlank> > <restriction_changes>+BamHI, +BinI, +NlaIV, > +XhoII</restriction_changes> > </DNA> > <RNA number="1" start="100" end="100" length="0" isMutation="1"> > <label>frameshift</label> > <label>insertion</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori></allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atccagaacccgggccccaggcacc</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>+BamHI, +BinI, +NlaIV, > +XhoII</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100AT>GGGCCC" > trivname="I34ins82X"> > <DNA number="1" start="100" end="101" length="2" isMutation="1"> > <label>complex</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>at</allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, > +SduI</restriction_changes> > </DNA> > <RNA number="1" start="100" end="101" length="2" isMutation="1"> > <label>frameshift</label> > <label>complex</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>at</allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, > +SduI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.-1G>A"> > <DNA number="1" start="-1" end="-1" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>ggtggaagattcagccaagctcaag</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>atggaagtgcagttagggctgggaa</dnFlank> > <restriction_changes>-BccI, -FokI, +Hpy178III</restriction_changes> > </DNA> > <RNA number="1" start="-1" end="-1" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>ggtggaagattcagccaagctcaag</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>atggaagtgcagttagggctgggaa</dnFlank> > <restriction_changes>-BccI, -FokI, +Hpy178III</restriction_changes> > <region>5'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+2766T>C"> > <DNA number="1" start="2766" end="2766" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>tctatttccacacccagtgaagcat</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>c</allele_mut> > <dnFlank>ggaaaccctatttccccaccccagc</dnFlank> > <restriction_changes>+Hpy188I, +SfaNI, -XcmI</restriction_changes> > </DNA> > <RNA number="1" start="2766" end="2766" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>tctatttccacacccagtgaagcat</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>c</allele_mut> > <dnFlank>ggaaaccctatttccccaccccagc</dnFlank> > <restriction_changes>+Hpy188I, +SfaNI, -XcmI</restriction_changes> > <region>3'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+12165A>G"> > <DNA number="1" start="12165" end="12165" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>experimental</proof> > <upFlank>cgcacacctgtggtgcctgccaccc</upFlank> > <allele_ori>a</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>ctgggttgcccatgattcatttttg</dnFlank> > <restriction_changes>+AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, > -TspRI</restriction_changes> > <region dist="1027">3'UTR</region> > </DNA> > <RNA number="1" start="2428" end="2428" length="1" isMutation="1"> > <label>unknown</label> > <proof>computed</proof> > <upFlank>cgcacacctgtggtgcctgccaccc</upFlank> > <allele_ori>a</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>ctgggttgcccatgattcatttttg</dnFlank> > <restriction_changes>+AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, > -TspRI</restriction_changes> > <region dist="-1">3'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+4G>T" > trivname="V2F"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>gcagcactgcagagatttcatcatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>tctcccaggccctcaggctcctctg</dnFlank> > <restriction_changes>-BsmAI, -Eco31I</restriction_changes> > <region value="1" dist="4">exon</region> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gcagcactgcagagatttcatcatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>tctcccaggccctcaggctcctctg</dnFlank> > <codon codon_ori="gtc" codon_mut="ttc" codon_pos="1"></codon> > <restriction_changes>-BsmAI, -Eco31I</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>nonconservative</label> > <proof>computed</proof> > <allele_ori>V</allele_ori> > <allele_mut>F</allele_mut> > </AA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+1168G>T" > trivname="D34Y"> > <DNA number="1" start="1168" end="1168" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>taaggcctcaggaggagaaacacgg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>acatgccgtggaagccggggcctca</dnFlank> > <restriction_changes>-BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, > +Tsp4CI</restriction_changes> > <region value="1" dist="-29">exon</region> > </DNA> > <RNA number="1" start="100" end="100" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>taaggcctcaggaggagaaacacgg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>acatgccgtggaagccggggcctca</dnFlank> > <codon codon_ori="gac" codon_mut="tac" codon_pos="1"></codon> > <restriction_changes>-BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, > +Tsp4CI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>substitution</label> > <label>nonconservative</label> > <proof>computed</proof> > <allele_ori>D</allele_ori> > <allele_mut>Y</allele_mut> > </AA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.-4C>G"> > <DNA number="1" start="-4" end="-4" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>ggcaggggcagcactgcagagattt</upFlank> > <allele_ori>c</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atcatggtctcccaggccctcaggc</dnFlank> > <restriction_changes>+BclI, +DpnI, +MboI</restriction_changes> > <region dist="-4">5'UTR</region> > </DNA> > <RNA number="1" start="-4" end="-4" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>ggcaggggcagcactgcagagattt</upFlank> > <allele_ori>c</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atcatggtctcccaggccctcaggc</dnFlank> > <restriction_changes>+BclI, +DpnI, +MboI</restriction_changes> > <region dist="31">5'UTR</region> > </RNA> > </seqDiff> Failed 3/25 subtests t/WABA.........................ok t/XEMBL_DB.....................SOAP::Lite and/or XML::DOM not installed. This means that Bio::DB::XEMBL module is not usable. Skipping tests. ok Test Summary Report ------------------- t/Biblio.t (Wstat: 0 Tests: 24 Failed: 0) Tests skipped: 2 t/BioFetch_DB.t (Wstat: 0 Tests: 27 Failed: 1) Failed tests: 8 t/EMBL_DB.t (Wstat: 0 Tests: 15 Failed: 3) Failed tests: 6, 13-14 t/Genewise.t (Wstat: 0 Tests: 51 Failed: 0) Tests skipped: 33-34 t/MeSH.t (Wstat: 0 Tests: 26 Failed: 1) Failed tests: 26 t/Ontology.t (Wstat: 2304 Tests: 0 Failed: 0) Non-zero exit status: 9 Parse errors: Bad plan. You planned 50 tests but ran 0. t/RemoteBlast.t (Wstat: 0 Tests: 6 Failed: 0) Tests skipped: 3-6 t/SeqIO.t (Wstat: 0 Tests: 235 Failed: 0) Tests skipped: 68, 114, 126 t/simpleGOparser.t (Wstat: 2304 Tests: 0 Failed: 0) Non-zero exit status: 9 Parse errors: Bad plan. You planned 98 tests but ran 0. t/Taxonomy.t (Wstat: 0 Tests: 8 Failed: 0) Tests skipped: 2-8 t/Variation_IO.t (Wstat: 0 Tests: 25 Failed: 3) Failed tests: 15, 20, 25 Files=179, Tests=8125, 311 wallclock secs (217.98 cusr + 7.46 csys = 225.44 CPU) Result: FAIL Failed 6/179 test programs. 8/8125 subtests failed. make: *** [test_dynamic] Error 255 -- Summary of my perl5 (revision 5 version 8 subversion 8 patch 31223) configuration: Platform: osname=linux, osvers=2.6.22-1-k7, archname=i686-linux-thread-multi-64int uname='linux k75 2.6.22-1-k7 #1 smp sun jul 29 15:15:55 utc 2007 i686 gnulinux ' config_args='-Dprefix=/home/src/perl/repoperls/installed-perls/maint-5.8/pFrR8O4/[EMAIL PROTECTED] -Dinstallusrbinperl=n -Uversiononly -Doptimize=-g -des -Duse64bitint -Dusedevel -Dusethreads' hint=recommended, useposix=true, d_sigaction=define usethreads=define use5005threads=undef useithreads=define usemultiplicity=define useperlio=define d_sfio=undef uselargefiles=define usesocks=undef use64bitint=define use64bitall=undef uselongdouble=undef usemymalloc=n, bincompat5005=undef Compiler: cc='cc', ccflags ='-D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS -DDEBUGGING -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64', optimize='-g', cppflags='-D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS -DDEBUGGING -fno-strict-aliasing -pipe -I/usr/local/include' ccversion='', gccversion='4.1.2 20061115 (prerelease) (Debian 4.1.1-21)', gccosandvers='' intsize=4, longsize=4, ptrsize=4, doublesize=8, byteorder=12345678 d_longlong=define, longlongsize=8, d_longdbl=define, longdblsize=12 ivtype='long long', ivsize=8, nvtype='double', nvsize=8, Off_t='off_t', lseeksize=8 alignbytes=4, prototype=define Linker and Libraries: ld='cc', ldflags =' -L/usr/local/lib' libpth=/usr/local/lib /lib /usr/lib /usr/lib64 libs=-lnsl -lgdbm -ldb -ldl -lm -lcrypt -lutil -lpthread -lc perllibs=-lnsl -ldl -lm -lcrypt -lutil -lpthread -lc libc=/lib/libc-2.6.1.so, so=so, useshrplib=false, libperl=libperl.a gnulibc_version='2.6.1' Dynamic Linking: dlsrc=dl_dlopen.xs, dlext=so, d_dlsymun=undef, ccdlflags='-Wl,-E' cccdlflags='-fPIC', lddlflags='-shared -g -L/usr/local/lib'
