This distribution has been tested as part of the cpan-testers effort to test as many new uploads to CPAN as possible. See http://testers.cpan.org/
Please cc any replies to [email protected] to keep other test volunteers informed and to prevent any duplicate effort. -- Dear Ewan Birney, This is a computer-generated test report for bioperl-1.4, created automatically by CPAN::Reporter, version 0.99_11, and sent to the CPAN Testers mailing list. If you have received this email directly, it is because the person testing your distribution chose to send a copy to your CPAN email address; there may be a delay before the official report is received and processed by CPAN Testers. Thank you for uploading your work to CPAN. However, it appears that there were some problems testing your distribution. Sections of this report: * Tester comments * Prerequisites * Environment and other context * Test output ------------------------------ TESTER COMMENTS ------------------------------ Additional comments from tester: [none provided] ------------------------------ PREREQUISITES ------------------------------ Prerequisite modules loaded: requires: Module Need Have -------------- ---- ----- DB_File 0 1.815 File::Spec 0 3.25 File::Temp 0 0.18 HTML::Entities 0 1.35 IO::Scalar 0 2.110 IO::String 0 1.08 ------------------------------ ENVIRONMENT AND OTHER CONTEXT ------------------------------ Environment variables: LANG = C PATH = /usr/lib/ccache:/home/sand/bin:/usr/local/bin:/usr/bin:/bin:/usr/bin/X11:/usr/games:/usr/local/perl/bin:/usr/X11/bin:/sbin:/usr/sbin PERL5LIB = PERL5_CPANPLUS_IS_RUNNING = 23433 PERL5_CPAN_IS_RUNNING = 23433 PERL_MM_USE_DEFAULT = 1 SHELL = /usr/bin/zsh TERM = screen Perl special variables (and OS-specific diagnostics, for MSWin32): Perl: $^X = /home/src/perl/repoperls/installed-perls/perl/pNUSF0c/[EMAIL PROTECTED]/bin/perl UID: $< = 1005 EUID: $> = 1005 GID: $( = 1005 1005 EGID: $) = 1005 1005 Perl module toolchain versions installed: Module Have ------------------- ------- CPAN 1.92 Cwd 3.25 ExtUtils::CBuilder 0.19 ExtUtils::Command 1.13 ExtUtils::Install 1.44 ExtUtils::MakeMaker 6.36 ExtUtils::Manifest 1.51_01 ExtUtils::ParseXS 2.18 File::Spec 3.25 Module::Build 0.2808 Module::Signature 0.55 Test::Harness 2.64 Test::More 0.72 YAML 0.65 YAML::Syck 0.97 version 0.7203 ------------------------------ TEST OUTPUT ------------------------------ Output from '/usr/bin/make test': PERL_DL_NONLAZY=1 /home/src/perl/repoperls/installed-perls/perl/pNUSF0c/[EMAIL PROTECTED]/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/AAChange...................ok t/AAReverseMutate............ok t/AlignIO....................ok t/AlignStats.................ok t/Allele.....................ok t/Alphabet...................ok t/Annotation.................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/AnnotationAdaptor..........ok t/Assembly...................ok t/Biblio.....................SOAP::Lite not installed. Skipping some tests. ok 1/24 skipped: various reasons t/Biblio_biofetch............ok t/BiblioReferences...........ok t/BioDBGFF...................ok t/BioFetch_DB................FAILED test 8 Failed 1/27 tests, 96.30% okay t/BioGraphics................ok t/BlastIndex.................ok t/BPbl2seq...................ok t/BPlite.....................ok t/BPpsilite..................ok t/Chain......................ok t/cigarstring................ok t/ClusterIO..................ok t/Coalescent.................ok t/CodonTable.................ok t/consed.....................ok t/CoordinateGraph............ok t/CoordinateMapper...........ok t/Correlate..................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/CytoMap....................ok t/DB.........................ok t/DBCUTG.....................ok t/DBFasta....................ok t/DNAMutation................ok t/Domcut.....................ok t/ECnumber...................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/ELM........................ -------------------- WARNING --------------------- MSG: Bio::Tools::Analysis::Protein::ELM Request Error: 400 URL must be absolute Content-Type: text/plain Client-Date: Sun, 23 Sep 2007 14:30:07 GMT Client-Warning: Internal response 400 URL must be absolute --------------------------------------------------- ok t/EMBL_DB....................FAILED tests 6, 13-14 Failed 3/15 tests, 80.00% okay t/EMBOSS_Tools...............ok t/EncodedSeq.................ok t/ePCR.......................ok t/ESEfinder..................ok t/est2genome.................ok t/Exception..................ok t/Exonerate..................ok t/flat.......................ok t/FootPrinter................ok t/game.......................ok t/GDB........................ok t/GeneCoordinateMapper....... -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- Use of uninitialized value in concatenation (.) or string at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Coordinate/GeneMapper.pm line 814. ok t/Geneid.....................ok t/Genewise...................ok 2/51 skipped: various reasons t/Genomewise.................ok t/Genpred....................ok t/GFF........................Filehandle GEN0 opened only for output at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/IO.pm line 440. Filehandle GEN1 opened only for output at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/IO.pm line 440. ok t/GOR4.......................ok t/GOterm.....................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/GuessSeqFormat.............ok t/hmmer......................ok t/HNN........................ok t/Index......................ok t/InstanceSite...............ok t/InterProParser.............Useless localization of scalar assignment at Bio/Root/Object.pm line 699. ok t/IUPAC......................ok t/largefasta.................ok t/largepseq..................ok t/LinkageMap.................ok t/LiveSeq....................ok t/LocatableSeq...............ok t/Location...................ok t/LocationFactory............ok t/LocusLink..................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/lucy.......................ok t/Map........................ok t/MapIO......................ok t/Matrix.....................ok t/Measure....................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/MeSH.......................Use of uninitialized value $desc in substitution (s///) at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/DB/MeSH.pm line 263. Use of uninitialized value $name in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value $name in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value $name in regexp compilation at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/DB/MeSH.pm line 277. FAILED test 26 Failed 1/26 tests, 96.15% okay t/MetaSeq....................ok t/MicrosatelliteMarker.......ok t/MiniMIMentry...............Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/MitoProt...................ok t/Molphy.....................ok t/multiple_fasta.............ok t/Mutation...................ok t/Mutator....................ok t/NetPhos....................ok t/Node.......................ok t/OddCodes...................ok t/OMIMentry..................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/OMIMentryAllelicVariant....Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/OMIMparser.................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/Ontology...................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. set_attribute: not a compat02 graph at /home/src/perl/repoperls/installed-perls/perl/pNUSF0c/[EMAIL PROTECTED]/lib/site_perl/5.9.5/Graph.pm line 2394, <GEN0> line 10. dubious Test returned status 9 (wstat 2304, 0x900) DIED. FAILED tests 1-50 Failed 50/50 tests, 0.00% okay t/OntologyEngine.............Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/PAML.......................ok t/Perl.......................ok t/phd........................ok t/Phenotype..................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/PhylipDist.................ok t/pICalculator...............ok t/Pictogram..................ok t/PopGen.....................ok t/PopGenSims.................ok t/primaryqual................ok t/PrimarySeq.................ok t/primedseq..................ok t/Primer.....................ok t/primer3....................ok t/Promoterwise...............ok t/ProtDist...................ok t/psm........................ok t/QRNA.......................ok t/qual.......................ok t/RandDistFunctions..........ok t/RandomTreeFactory..........ok t/Range......................ok t/RangeI.....................ok t/RefSeq.....................ok t/Registry...................ok t/Relationship...............Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/RelationshipType...........Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/RemoteBlast................ok 4/6 skipped: various reasons t/RepeatMasker...............ok t/RestrictionAnalysis........ok t/RestrictionEnzyme..........ok t/RestrictionIO..............ok t/RNAChange..................ok t/RootI......................ok t/RootIO.....................ok t/RootStorable...............ok t/Scansite...................ok t/scf........................ok t/SearchDist.................ok t/SearchIO...................ok t/Seq........................ok t/SeqAnalysisParser..........ok t/SeqBuilder.................ok t/SeqDiff....................ok t/SeqFeatCollection..........ok t/SeqFeature.................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/seqfeaturePrimer...........ok t/SeqIO......................ok 3/235 skipped: various reasons t/SeqPattern.................ok t/SeqStats...................ok t/SequenceFamily.............ok t/sequencetrace..............ok t/SeqUtils...................ok t/seqwithquality.............ok t/SeqWords...................ok t/Sigcleave..................ok t/Sim4.......................ok t/SimilarityPair.............ok t/SimpleAlign................ok t/simpleGOparser.............Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. set_attribute: not a compat02 graph at /home/src/perl/repoperls/installed-perls/perl/pNUSF0c/[EMAIL PROTECTED]/lib/site_perl/5.9.5/Graph.pm line 2394, <GEN1> line 14. dubious Test returned status 9 (wstat 2304, 0x900) DIED. FAILED tests 1-98 Failed 98/98 tests, 0.00% okay t/sirna......................ok t/SiteMatrix.................ok t/SNP........................ok t/Sopma......................ok t/Species....................ok t/splicedseq.................ok t/StandAloneBlast............ok t/StructIO...................ok t/Structure..................ok t/Swiss......................ok t/Symbol.....................ok t/Taxonomy...................ok 7/8 skipped: various reasons t/Tempfile...................ok t/Term.......................Useless localization of scalar assignment at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/Bio/Root/Object.pm line 699. ok t/Tools......................ok t/Tree.......................ok t/TreeIO.....................FAILED test 42 Failed 1/41 tests, 97.56% okay t/trim.......................ok t/tutorial...................Use of uninitialized value in print at /home/sand/.cpan/build/bioperl-1.4-Xouv4E/blib/lib/bptutorial.pl line 4042, <GEN20> line 934. ok t/UCSCParsers................ok t/Unflattener................ok t/Unflattener2...............ok t/UniGene....................ok t/Variation_IO...............1d0 < 32d30 < 60d57 < 91d87 < 121d116 < 152d146 < 183d176 < 214d206 < 245d236 < 268d258 < 291d280 < 315d303 < 347d334 < 379d365 < 1d0 < 1,350c1,388 < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+14T>A; L5X < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 14 < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature RNA; 1 < Feature /label: nonsense < Feature /proof: experimental < Feature /location: 14 (M20132::376) < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature /codon_table: 1 < Feature /codon: tta>taa; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: truncation < Feature /proof: computed < Feature /location: 5 < Feature /change: L>* < // < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+100delATCCAG; I34del-2 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 100..105 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature RNA; 1 < Feature /label: inframe, deletion < Feature /proof: experimental < Feature /location: 100..105 (M20132::462..467) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 34..35 < Feature /change: IQ> < // < ID M20132:(362)c.+101delT; I34delX172 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature RNA; 1 < Feature /label: frameshift, deletion < Feature /proof: experimental < Feature /location: 101 (M20132::463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAP < Feature GSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPAR < Feature GCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* < // < ID M20132:(362)c.+101insGGGCCC; I34ins+2 < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 100^101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature RNA; 1 < Feature /label: inframe, insertion < Feature /proof: experimental < Feature /location: 100^101 (M20132::462^463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: insertion, complex < Feature /proof: computed < Feature /location: 34 < Feature /change: I>RAL < // < ID M20132:(362)c.+100insG; I34ins81X < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 99^100 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature RNA; 1 < Feature /label: frameshift, insertion < Feature /proof: experimental < Feature /location: 99^100 (M20132::461^462) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362)c.+100AT>GGGCCC; I34ins82X < Feature DNA; 1 < Feature /label: complex < Feature /proof: computed < Feature /location: 100..101 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature RNA; 1 < Feature /label: frameshift, complex < Feature /proof: experimental < Feature /location: 100..101 (M20132::462..463) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362+1)c.-1G>A < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: -1 < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -1 (M20132::361) < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature /region: 5'UTR < // < ID M20132:(362)c.+2766T>C < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 2766 < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: 2766 (M20132::3128) < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature /region: 3'UTR < // < ID J02933:(521)g.+12165A>G < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: experimental < Feature /location: 12165 (J02933::12686) < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (+1027) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: computed < Feature /location: 2428 < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (-1) < // < ID J02933:(521)g.+4G>T; V2F < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 4 (J02933::525) < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /region: exon; 1 (+4) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /codon_table: 1 < Feature /codon: gtc>ttc; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 2 < Feature /change: V>F < // < ID J02933:(521)g.+1168G>T; D34Y < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 1168 (J02933::1689) < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /region: exon; 1 (-29) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 100 < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /codon_table: 1 < Feature /codon: gac>tac; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 34 < Feature /change: D>Y < // < ID J02933:(521+1)g.-4C>G < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: -4 (J02933::518) < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (-4) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -4 < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (+31) < // --- > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+4G>A" > trivname="E2K"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <restriction_changes>-BccI</restriction_changes> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <codon codon_ori="gaa" codon_mut="aaa" codon_pos="1"></codon> > <restriction_changes>-BccI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>conservative</label> > <proof>computed</proof> > <allele_ori>E</allele_ori> > <allele_mut>K</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+14T>A" > trivname="L5X"> > <DNA number="1" start="14" end="14" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>ccaagctcaaggatggaagtgcagt</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>agggctgggaagggtctaccctcgg</dnFlank> > </DNA> > <RNA number="1" start="14" end="14" length="1" isMutation="1"> > <label>nonsense</label> > <proof>experimental</proof> > <upFlank>ccaagctcaaggatggaagtgcagt</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>agggctgggaagggtctaccctcgg</dnFlank> > <codon codon_ori="tta" codon_mut="taa" codon_pos="2"></codon> > <region>coding</region> > </RNA> > <AA number="1" start="5" end="5" length="1" isMutation="1"> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>L</allele_ori> > <allele_mut>*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+4G>A" > trivname="E2K"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <restriction_changes>-BccI</restriction_changes> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gaagattcagccaagctcaaggatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>aagtgcagttagggctgggaagggt</dnFlank> > <codon codon_ori="gaa" codon_mut="aaa" codon_pos="1"></codon> > <restriction_changes>-BccI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>conservative</label> > <proof>computed</proof> > <allele_ori>E</allele_ori> > <allele_mut>K</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100delATCCAG" > trivname="I34del-2"> > <DNA number="1" start="100" end="105" length="6" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>atccag</allele_ori> > <allele_mut></allele_mut> > <dnFlank>aacccgggccccaggcacccagagg</dnFlank> > <restriction_changes>-BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, > +MjaIV</restriction_changes> > </DNA> > <RNA number="1" start="100" end="105" length="6" isMutation="1"> > <label>inframe</label> > <label>deletion</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>atccag</allele_ori> > <allele_mut></allele_mut> > <dnFlank>aacccgggccccaggcacccagagg</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>-BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, > +MjaIV</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="35" length="2" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <allele_ori>IQ</allele_ori> > <allele_mut></allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+101delT" > trivname="I34delX172"> > <DNA number="1" start="101" end="101" length="1" isMutation="1"> > <label>deletion</label> > <proof>computed</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori>t</allele_ori> > <allele_mut></allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <restriction_changes>-BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, > +Tsp45I</restriction_changes> > </DNA> > <RNA number="1" start="101" end="101" length="1" isMutation="1"> > <label>frameshift</label> > <label>deletion</label> > <proof>experimental</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori>t</allele_ori> > <allele_mut></allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <codon codon_ori="atc" codon_pos="2"></codon> > <restriction_changes>-BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, > +Tsp45I</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+101insGGGCCC" > trivname="I34ins+2"> > <DNA number="1" start="101" end="101" length="0" isMutation="1"> > <label>insertion</label> > <proof>computed</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori></allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>tccagaacccgggccccaggcaccc</dnFlank> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, > +SduI</restriction_changes> > </DNA> > <RNA number="1" start="101" end="101" length="0" isMutation="1"> > <label>inframe</label> > <label>insertion</label> > <proof>experimental</proof> > <upFlank>ctgttccagagcgtgcgcgaagtga</upFlank> > <allele_ori></allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>tccagaacccgggccccaggcaccc</dnFlank> > <codon codon_ori="atc" codon_pos="2"></codon> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, > +SduI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>insertion</label> > <label>complex</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > <allele_mut>RAL</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100insG" > trivname="I34ins81X"> > <DNA number="1" start="100" end="100" length="0" isMutation="1"> > <label>insertion</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori></allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atccagaacccgggccccaggcacc</dnFlank> > <restriction_changes>+BamHI, +BinI, +NlaIV, > +XhoII</restriction_changes> > </DNA> > <RNA number="1" start="100" end="100" length="0" isMutation="1"> > <label>frameshift</label> > <label>insertion</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori></allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atccagaacccgggccccaggcacc</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>+BamHI, +BinI, +NlaIV, > +XhoII</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+100AT>GGGCCC" > trivname="I34ins82X"> > <DNA number="1" start="100" end="101" length="2" isMutation="1"> > <label>complex</label> > <proof>computed</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>at</allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, > +SduI</restriction_changes> > </DNA> > <RNA number="1" start="100" end="101" length="2" isMutation="1"> > <label>frameshift</label> > <label>complex</label> > <proof>experimental</proof> > <upFlank>tctgttccagagcgtgcgcgaagtg</upFlank> > <allele_ori>at</allele_ori> > <allele_mut>gggccc</allele_mut> > <dnFlank>ccagaacccgggccccaggcaccca</dnFlank> > <codon codon_ori="atc" codon_pos="1"></codon> > <restriction_changes>+ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, > -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, > +SduI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>out-of-frame translation</label> > <label>truncation</label> > <proof>computed</proof> > <allele_ori>I</allele_ori> > > <allele_mut>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD*</allele_mut> > </AA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.-1G>A"> > <DNA number="1" start="-1" end="-1" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>ggtggaagattcagccaagctcaag</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>atggaagtgcagttagggctgggaa</dnFlank> > <restriction_changes>-BccI, -FokI, +Hpy178III</restriction_changes> > </DNA> > <RNA number="1" start="-1" end="-1" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>ggtggaagattcagccaagctcaag</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>a</allele_mut> > <dnFlank>atggaagtgcagttagggctgggaa</dnFlank> > <restriction_changes>-BccI, -FokI, +Hpy178III</restriction_changes> > <region>5'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="M20132" moltype="rna" offset="362" sysname="c.+2766T>C"> > <DNA number="1" start="2766" end="2766" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>computed</proof> > <upFlank>tctatttccacacccagtgaagcat</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>c</allele_mut> > <dnFlank>ggaaaccctatttccccaccccagc</dnFlank> > <restriction_changes>+Hpy188I, +SfaNI, -XcmI</restriction_changes> > </DNA> > <RNA number="1" start="2766" end="2766" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>tctatttccacacccagtgaagcat</upFlank> > <allele_ori>t</allele_ori> > <allele_mut>c</allele_mut> > <dnFlank>ggaaaccctatttccccaccccagc</dnFlank> > <restriction_changes>+Hpy188I, +SfaNI, -XcmI</restriction_changes> > <region>3'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+12165A>G"> > <DNA number="1" start="12165" end="12165" length="1" isMutation="1"> > <label>point</label> > <label>transition</label> > <proof>experimental</proof> > <upFlank>cgcacacctgtggtgcctgccaccc</upFlank> > <allele_ori>a</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>ctgggttgcccatgattcatttttg</dnFlank> > <restriction_changes>+AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, > -TspRI</restriction_changes> > <region dist="1027">3'UTR</region> > </DNA> > <RNA number="1" start="2428" end="2428" length="1" isMutation="1"> > <label>unknown</label> > <proof>computed</proof> > <upFlank>cgcacacctgtggtgcctgccaccc</upFlank> > <allele_ori>a</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>ctgggttgcccatgattcatttttg</dnFlank> > <restriction_changes>+AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, > -TspRI</restriction_changes> > <region dist="-1">3'UTR</region> > </RNA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+4G>T" > trivname="V2F"> > <DNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>gcagcactgcagagatttcatcatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>tctcccaggccctcaggctcctctg</dnFlank> > <restriction_changes>-BsmAI, -Eco31I</restriction_changes> > <region value="1" dist="4">exon</region> > </DNA> > <RNA number="1" start="4" end="4" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>gcagcactgcagagatttcatcatg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>tctcccaggccctcaggctcctctg</dnFlank> > <codon codon_ori="gtc" codon_mut="ttc" codon_pos="1"></codon> > <restriction_changes>-BsmAI, -Eco31I</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="2" end="2" length="1" isMutation="1"> > <label>substitution</label> > <label>nonconservative</label> > <proof>computed</proof> > <allele_ori>V</allele_ori> > <allele_mut>F</allele_mut> > </AA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.+1168G>T" > trivname="D34Y"> > <DNA number="1" start="1168" end="1168" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>taaggcctcaggaggagaaacacgg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>acatgccgtggaagccggggcctca</dnFlank> > <restriction_changes>-BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, > +Tsp4CI</restriction_changes> > <region value="1" dist="-29">exon</region> > </DNA> > <RNA number="1" start="100" end="100" length="1" isMutation="1"> > <label>missense</label> > <proof>experimental</proof> > <upFlank>taaggcctcaggaggagaaacacgg</upFlank> > <allele_ori>g</allele_ori> > <allele_mut>t</allele_mut> > <dnFlank>acatgccgtggaagccggggcctca</dnFlank> > <codon codon_ori="gac" codon_mut="tac" codon_pos="1"></codon> > <restriction_changes>-BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, > +Tsp4CI</restriction_changes> > <region>coding</region> > </RNA> > <AA number="1" start="34" end="34" length="1" isMutation="1"> > <label>substitution</label> > <label>nonconservative</label> > <proof>computed</proof> > <allele_ori>D</allele_ori> > <allele_mut>Y</allele_mut> > </AA> > </seqDiff> > <seqDiff id="J02933" moltype="dna" offset="521" sysname="g.-4C>G"> > <DNA number="1" start="-4" end="-4" length="1" isMutation="1"> > <label>point</label> > <label>transversion</label> > <proof>computed</proof> > <upFlank>ggcaggggcagcactgcagagattt</upFlank> > <allele_ori>c</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atcatggtctcccaggccctcaggc</dnFlank> > <restriction_changes>+BclI, +DpnI, +MboI</restriction_changes> > <region dist="-4">5'UTR</region> > </DNA> > <RNA number="1" start="-4" end="-4" length="1" isMutation="1"> > <label>unknown</label> > <proof>experimental</proof> > <upFlank>ggcaggggcagcactgcagagattt</upFlank> > <allele_ori>c</allele_ori> > <allele_mut>g</allele_mut> > <dnFlank>atcatggtctcccaggccctcaggc</dnFlank> > <restriction_changes>+BclI, +DpnI, +MboI</restriction_changes> > <region dist="31">5'UTR</region> > </RNA> > </seqDiff> FAILED tests 15, 20, 25 Failed 3/25 tests, 88.00% okay t/WABA.......................ok t/XEMBL_DB...................SOAP::Lite and/or XML::DOM not installed. This means that Bio::DB::XEMBL module is not usable. Skipping tests. ok Failed Test Stat Wstat Total Fail List of Failed ------------------------------------------------------------------------------- t/BioFetch_DB.t 27 1 8 t/EMBL_DB.t 15 3 6 13-14 t/MeSH.t 26 1 26 t/Ontology.t 9 2304 50 100 1-50 t/TreeIO.t 41 1 42 t/Variation_IO.t 25 3 15 20 25 t/simpleGOparser.t 9 2304 98 196 1-98 17 subtests skipped. Failed 7/179 test scripts. 155/8273 subtests failed. Files=179, Tests=8273, 588 wallclock secs (235.08 cusr + 7.37 csys = 242.45 CPU) Failed 7/179 test programs. 155/8273 subtests failed. make: *** [test_dynamic] Error 255 -- Summary of my perl5 (revision 5 version 9 subversion 5) configuration: Platform: osname=linux, osvers=2.6.22-1-k7, archname=i686-linux-64int uname='linux k75 2.6.22-1-k7 #1 smp mon jul 23 14:02:09 utc 2007 i686 gnulinux ' config_args='-Dprefix=/home/src/perl/repoperls/installed-perls/perl/pNUSF0c/[EMAIL PROTECTED] -Dinstallusrbinperl=n -Uversiononly -Doptimize=-g -des -Duse64bitint -Dusedevel' hint=recommended, useposix=true, d_sigaction=define useithreads=undef, usemultiplicity=undef useperlio=define, d_sfio=undef, uselargefiles=define, usesocks=undef use64bitint=define, use64bitall=undef, uselongdouble=undef usemymalloc=n, bincompat5005=undef Compiler: cc='cc', ccflags ='-DDEBUGGING -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64', optimize='-g', cppflags='-DDEBUGGING -fno-strict-aliasing -pipe -I/usr/local/include' ccversion='', gccversion='4.1.2 20061115 (prerelease) (Debian 4.1.1-21)', gccosandvers='' intsize=4, longsize=4, ptrsize=4, doublesize=8, byteorder=12345678 d_longlong=define, longlongsize=8, d_longdbl=define, longdblsize=12 ivtype='long long', ivsize=8, nvtype='double', nvsize=8, Off_t='off_t', lseeksize=8 alignbytes=4, prototype=define Linker and Libraries: ld='cc', ldflags =' -L/usr/local/lib' libpth=/usr/local/lib /lib /usr/lib /usr/lib64 libs=-lnsl -lgdbm -ldb -ldl -lm -lcrypt -lutil -lc perllibs=-lnsl -ldl -lm -lcrypt -lutil -lc libc=/lib/libc-2.6.so, so=so, useshrplib=false, libperl=libperl.a gnulibc_version='2.6' Dynamic Linking: dlsrc=dl_dlopen.xs, dlext=so, d_dlsymun=undef, ccdlflags='-Wl,-E' cccdlflags='-fPIC', lddlflags='-shared -g -L/usr/local/lib'
