Source: vg
Version: 1.24.0+ds-1
Severity: serious
Justification: FTBFS on amd64
Tags: bullseye sid ftbfs
Usertags: ftbfs-20200620 ftbfs-bullseye
Hi,
During a rebuild of all packages in sid, your package failed to build
on amd64.
Relevant part (hopefully):
> debian/rules override_dh_auto_test-arch
> make[1]: Entering directory '/<<PKGBUILDDIR>>'
> export PATH=$PATH:/<<PKGBUILDDIR>>/debian/help && . ./source_me.sh && cd test
> && prove -v t
> index file /tmp/vg-gguSCo/vg-syE3Ap.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-6RlV5n.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-1W23ar.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-ud2rPq.fai not found, generating...
> warning:[vg::Constructor] Unsupported variant allele "<DEL>"; Skipping
> variant(s) x 9 sv1 N <DEL> 99 PASS
> AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SVTYPE=DEL GT !
> index file /tmp/vg-gguSCo/vg-1iuP8q.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-rn9CWm.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-HdBZ9o.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-WDJHMp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-sP84vq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-btF5Cn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-y1Zapp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-3c0pFn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-6Gfjco.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-a1SZun.fai not found, generating...
> Warning: deletion END and SVLEN do not agree [canonicalize] x 9 sv1
> N <DEL> 99 PASS
> AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SPAN=19;SVLEN=-19;SVTYPE=DEL GT
> END: 29 SVLEN: -19
> index file /tmp/vg-gguSCo/vg-FhOCUm.fai not found, generating...
> Warning: deletion END and SVLEN do not agree [canonicalize] x 9 sv1
> N <DEL> 99 PASS
> AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SPAN=19;SVLEN=-19;SVTYPE=DEL GT
> END: 29 SVLEN: -19
> index file /tmp/vg-gguSCo/vg-EH5Jlp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-wnyCyq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-QMWW0p.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-R33A1o.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-lZXqKq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-mv5Yzn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-Ig3qeq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-DVYKTm.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-17Wq4n.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not
> canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99
> PASS
> AC=1;CIPOS=0,3;END=18;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 18 POS: 9
> index file /tmp/vg-gguSCo/vg-Teyo8o.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not
> canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99
> PASS
> AC=1;CIPOS=0,3;END=18;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 18 POS: 9
> index file /tmp/vg-gguSCo/vg-mo7Ran.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not
> canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99
> PASS
> AC=1;CIPOS=0,3;END=13;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 13 POS: 9
> Warning: VCF writer incorrecty produced END = POS + SVLEN for an insertion.
> Fixing END to POS.
> index file /tmp/vg-gguSCo/vg-TZReAn.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not
> canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99
> PASS
> AC=1;CIPOS=0,3;END=13;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 13 POS: 9
> Warning: VCF writer incorrecty produced END = POS + SVLEN for an insertion.
> Fixing END to POS.
> index file /tmp/vg-gguSCo/vg-oWYqqo.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-m8Na5q.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-31hESq.fai not found, generating...
> warning:[vg::Constructor] Lowercase characters found in x; coercing to
> uppercase.
> index file /tmp/vg-gguSCo/vg-eG31xq.fai not found, generating...
> warning:[vg::Constructor] Lowercase characters found in x; coercing to
> uppercase.
> index file /tmp/vg-gguSCo/vg-TBAUoq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-WQEhkn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-JWE3bp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-fy4xbn.fai not found, generating...
> Warning: Cactus does not currently support finding snarls in a single-node
> connected component
> t/00_unittest.t .......
> 1..1
> ===============================================================================
> All tests passed (7524960 assertions in 429 test cases)
> ok 1 - vg unit tests complete successfully
> ok
> t/01_build_graph.t ....
> 1..1
> ok 1 - graph building with the API
> ok
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping
> variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS
>
> AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL
> !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping
> variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100
> PASS
> AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null
> !
> warning:[vg::Constructor] Unsupported variant allele "<CN2>"; Skipping
> variant(s) z 490168 DUP_gs_CNV_20_1490168_1549769 G <CN2> 100
> PASS
> AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CS=DUP_gs;DP=21874;EAS_AF=0;END=1549769;EUR_AF=0;NS=2504;SAS_AF=0.001;SVTYPE=DUP
> !
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping
> variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS
>
> AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL
> !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping
> variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100
> PASS
> AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null
> !
> Restricting to gi|568815592:29791752-29792749 from 1 to end
> index file sv/x.fa.fai not found, generating...
> error:[vg::Constructor] non-ATGCN characters found in variant:
> x 973 . G A,* 99 .
> AC=2;LEN=1;NA=2;NS=1;TYPE=snp
> index file tiny/ambiguous.fa.fai not found, generating...
> warning:[vg::Constructor] Unsupported IUPAC ambiguity codes found in x;
> coercing to N.
> t/02_vg_construct.t ...
> 1..28
> ok 1 - construction produces the right number of nodes
> ok 2 - construction produces the right number of edges
> ok 3 - construction obeys rename and region options
> ok 4 - construction of a 1 megabase graph from the 1000 Genomes succeeds
> ok 5 - the 1mb graph has the expected number of nodes
> ok 6 - the 1mb graph has the expected number of edges
> ok 7 - node size is manageable by default
> ok 8 - construction of a very complex region succeeds
> ok 9 - the complex graph has the expected number of nodes
> ok 10 - the complex graph has the expected number of edges
> ok 11 - the ordering of variants at the same position has no effect on the
> resulting graph
> ok 12 - construction does not fail when the first position in the VCF is
> repeated and has an indel
> ok 13 - the size of the regions used in construction has no effect on the
> graph
> ok 14 - the number of threads used in construction has no effect on the graph
> ok 15 - the number of threads and regions used in construction has no effect
> on the graph
> ok 16 - construction of a graph with two head nodes succeeds
> ok 17 - the graph contains all the sequence in the reference and VCF
> ok 18 - varying the max node size does not affect graph length
> ok 19 - nodes are correctly capped in size
> ok 20 - -R --region flag is respected
> ok 21 - vg construct does not require a vcf
> ok 22 - vg construct respects node size limit
> ok 23 - --region can be interpreted to be a reference sequence (and not
> parsed as a region spec)
> ok 24 - vg constructs the correct graph for inversions
> ok 25 - vg construct skips variants with . ALTs
> ok 26 - VCF with * alleles is rejected
> ok 27 - Reference with ambiguity codes has them coerced to Ns
> ok 28 - Expected number of Ns are created
> ok
> t/03_vg_view.t ........
> 1..19
> ok 1 - view produces the expected number of lines of dot output
> ok 2 - view produces the expected number of lines of GFA output
> ok 3 - view converts back and forth between GFA and vg format
> ok 4 - view can convert BAM to GAM
> ok 5 - view can round-trip JSON and GAM
> ok 6 - view can reconstruct a VG graph from JSON
> ok 7 - view can pass through VG when loading as vg::VG
> ok 8 - view can pass through semantically identical VG normally
> ok 9 - view parses sample names
> ok 10 - view can handle fastq input
> ok 11 - view can translate graphs with 2-node cycles
> ok 12 - view outputs properly oriented GFA
> ok 13 - view produces the expected number of lines of dot output from a
> cyclic graph
> ok 14 - streaming JSON output produces the expected number of chunks
> ok 15 - duplicate warnings can be suppressed when loading as vg::VG
> ok 16 - gfa graphs with overlaps are rejected
> ok 17 - GFA import produces a concise error message when overlaps are present
> ok 18 - GFA import rejects a GFA file with an overlap that goes beyond its
> sequences
> ok 19 - GFA import produces a concise error message in that case
> ok
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> t/04_vg_align.t .......
> 1..20
> ok 1 - alignment traverses the correct path
> ok 2 - alignment score is as expected
> ok 3 - full length bonus works and is included by default
> ok 4 - bonuses are included on only one end for pinned alignments
> ok 5 - scoring parameters are respected
> ok 6 - score-matrix file should give same results as --match 2 --mismatch 2:
> scoring parameters are respected
> ok 7 - alignment does not contain excessive soft clips under lenient scoring
> ok 8 - score-matrix file should give same results as --match 2 --mismatch 2:
> alignment does not contain excessive soft clips under lenient scoring
> ok 9 - alignment score does not overflow at 255 when using 8x16bit vectors
> ok 10 - score-matrix file should give same results as --match 2 --mismatch 2:
> alignment score does not overflow at 255 when using 8x16bit vectors
> ok 11 - Ns do not cause excessive soft clipping
> ok 12 - nodes are only referenced if they have mappings
> ok 13 - align can use query names and outputs GAM
> ok 14 - alignment to cyclic graphs works
> ok 15 - graphs where duplicated nodes need flipping can be used for alignment
> ok 16 - node flipping doesn't destroy the alignment
> ok 17 - alignment correctly handles an inversion
> ok 18 - the exploding graph doesn't blow up
> ok 19 - pinning doesn't cause problems for gssw
> ok 20 - left pinning is correctly handled
> ok
> graph path 'x' invalid: edge from 202 end to 205 start does not exist
> [vg view] warning: graph is invalid!
> t/05_vg_find.t ........
> 1..28
> ok 1 - construction
> ok 2 - a path can be queried from the xg index
> ok 3 - a node near another can be obtained using context from the xg index
> ok 4 - each perfect read contains one maximal exact match
> ok 5 - vg find -D finds approximate distance between 2 adjacent node starts
> ok 6 - vg find -D finds approximate distance between node start and adjacent
> snp
> ok 7 - vg find -D jumps deletion
> ok 8 - vg find -D jumps deletion from other allele in snp
> ok 9 - vg find -L finds same number of nodes (with -c 1)
> ok 10 - vg find -L works with -r. it scans from start position of first node
> in range
> ok 11 - vg find -L tracks length from start position of input node
> ok 12 - vg find -L works with more than one input node
> ok 13 - we find the 4 canonical SMEMs from @lh3's bwa mem poster
> ok 14 - we can find the right MEMs for a sequence with Ns
> ok 15 - we find the same MEMs sequences with different lengths of Ns
> ok 16 - the index can return the set of alignments mapping to a particular
> node
> ok 17 - a subgraph query may be used to obtain a particular subset of
> alignments
> ok 18 - the GAM index can return the set of alignments mapping to a node
> ok 19 - a subgraph query may be used to obtain a particular subset of
> alignments from a sorted GAM
> ok 20 - the index can be queried using GAM alignments
> ok 21 - find gets connected edges between queried nodes by default
> ok 22 - find gets nodes provided in a node file list
> ok 23 - extracting by path adds no extra edges
> ok 24 - pattern based path extraction works
> ok 25 - path DAG range query works
> ok 26 - we can extract a set of targets to separate files
> ok 27 - the same extraction can be made using BED input
> ok 28 - we see the expected number of kmers in the given targets
> ok
> t/06_vg_index.t: line 8: warning: setlocale: LC_ALL: cannot change locale
> (en_US.utf8): No such file or directory
> error: could not parse i from argument "x.vg"
> t/06_vg_index.t .......
> 1..62
> ok 1 - building an XG index of a graph
> ok 2 - building a GCSA index of a graph
> ok 3 - building both indexes at once
> ok 4 - the indexes are identical when built one at a time and together
> ok 5 - building GCSA from XG
> ok 6 - the GCSA indexes are identical when built from vg and from xg
> ok 7 - building a GBWT index of a graph with haplotypes
> ok 8 - building an XG index of a graph with haplotypes
> ok 9 - xg index does not contain alt paths by default
> ok 10 - building an XG index of a graph with haplotypes and alt paths included
> ok 11 - xg index does contains alt paths with index -L
> ok 12 - building a GCSA index of a graph with haplotypes
> ok 13 - building all indexes at once
> ok 14 - the indexes are identical
> ok 15 - building all indexes at once, while leaving alt paths in xg
> ok 16 - the indexes are identical with -L
> ok 17 - xg index does contains alt paths with index -L all at once
> ok 18 - storing a VCF parse for a graph with haplotypes
> ok 19 - building a GBWT index from the VCF parse
> ok 20 - the indexes are identical
> ok 21 - samples can be excluded from haplotype indexing
> ok 22 - excluded samples were not included in the GBWT index
> ok 23 - building GBWT index for a regional graph
> ok 24 - no warnings about missing variants produced
> ok 25 - building an XG index of multiple graphs
> ok 26 - building a GCSA index of multiple graphs
> ok 27 - building both indexes at once
> ok 28 - the indexes are identical
> ok 29 - building a GBWT index of multiple graphs with haplotypes
> ok 30 - building an XG index of multiple graphs with haplotypes
> ok 31 - building a GCSA index of multiple graphs with haplotypes
> ok 32 - building all three indexes at once
> ok 33 - the indexes are identical
> ok 34 - storing a VCF parse for multiple graphs with haplotypes
> ok 35 - building a GBWT index from the VCF parses
> ok 36 - the indexes are identical
> ok 37 - GBWT can be built for paths
> ok 38 - GBWT can be built for both paths and haplotypes
> ok 39 - fail with nonexistent file
> ok 40 - a prebuilt deBruijn graph in GCSA2 format may be used
> ok 41 - index can store alignments
> ok 42 - index can dump alignments
> ok 43 - alignment index stores unmapped reads
> ok 44 - alignment index can be loaded using sequential invocations;
> next_nonce persistence
> ok 45 - index stores all mappings
> ok 46 - vg index and vg gamsort produce identical sorted GAM indexes
> ok 47 - threads may be exported to binary for use in GBWT construction
> ok 48 - storage of multiple graphs in an index succeeds
> ok 49 - can index backward nodes
> ok 50 - can index kmers for backward nodes
> ok 51 - index can store alignments to backward nodes
> ok 52 - index can store alignments to cyclic graphs
> ok 53 - GCSA2 index works on cyclic graphs with heads and tails
> ok 54 - GCSA2 index works on cyclic graphs with no heads or tails
> ok 55 - GCSA2 index works on cyclic graphs with self loops
> ok 56 - GCSA2 index works on general cyclic graphs
> ok 57 - GCSA2 indexing of a tiny graph works
> ok 58 - GCSA2 indexing succeeds on a single-node graph
> ok 59 - GCSA2 indexing succeeds on graph with heads but no tails
> ok 60 - a useful error message is produced when nodes are too large
> ok 61 - building a distance index of a graph
> ok 62 - building a distance index of a graph without maximum index
> ok
> t/07_vg_map.t: line 134: column: command not found
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> index file t.fa.fai not found, generating...
> t/07_vg_map.t .........
> 1..54
> ok 1 - offset counts unused bases from the start of the node on the forward
> strand
> ok 2 - xdrop alignment obtains the expected result
> ok 3 - xdrop alignment obtains the expected result for the reverse complement
> ok 4 - score-matrix defaults match 1 mismatch -4 should produce same results:
> with matrixoffset counts unused bases from the start of the node on the
> forward strand
> ok 5 - offset counts unused bases from the start of the node on the reverse
> strand
> ok 6 - global alignment traverses the correct path
> ok 7 - alignment score is as expected
> ok 8 - scoring parameters are respected
> ok 9 - score-matrix file should give same results as --match 2 --mismatch 2:
> scoring parameters are respected
> ok 10 - full length bonus always be included
> ok 11 - full length bonus can be set to 0
> ok 12 - vg map takes -d as input without a variant graph
> ok 13 - vg map can align across a SNP
> ok 14 - alignment works on a small graph
> ok 15 - binary alignment format is equivalent to json version
> ok 16 - alignment from BAM correctly handles qualities
> ok 17 - chunky-banded alignment works
> ok 18 - multiple alignments are returned in descending score order
> ok 19 - only a single primary alignment is returned
> ok 20 - mapping of BAM file produces expected number of alignments
> ok 21 - mapping from a fastq produces the expected number of alignments
> ok 22 - allowing secondary alignments with MEM mapping does not change number
> of primary alignments
> ok 23 - vg connects paired-end reads in gam output
> ok 24 - mapping to graphs that can't be oriented without swapping edges works
> correctly
> ok 25 - reads multi-map to multiple possible locations
> ok 26 - vg map works based on gcsa and xg indexes
> ok 27 - the mapping quality may be capped
> ok 28 - paired read alignments forced to be consistent have lower score than
> unrestricted alignments
> ok 29 - paired read alignments forced to be consistent are closer together in
> node id space than unrestricted alignments
> ok 30 - only primary alignments have mapping quality scores
> ok 31 - unpaired reads produce mapping quality scores
> ok 32 - map returns same output on xg and vg (single threaded)
> not ok 33 - unnamed test
> # got: '10'
> # expected: 'base quality adjusted alignment produces higher scores if
> mismatches have low quality'
> ok 34 - error on vg map -f <nonexistent-file> (unpaired)
> ok 35 - error on vg map -f <nonexistent-file> (interleaved)
> ok 36 - error on vg map -f <nonexistent-file> (paired, LHS)
> ok 37 - error on vg map -f <nonexistent-file> (paired, RHS)
> ok 38 - mapping a read that touches unused nodes gets the base score
> ok 39 - mapping a read that matches a haplotype gets a small penalty
> ok 40 - mapping a read that matches a haplotype with exponent 0 gets the base
> score
> ok 41 - mapping a read that matches no haplotypes gets a larger penalty
> ok 42 - surjection of paired reads to SAM yields correct positions
> ok 43 - surjection of paired reads to SAM yields correct pair partner
> positions
> ok 44 - surjection of paired reads to SAM yields properly matched QNAMEs
> ok 45 - surjection of paired reads to SAM produces correct pair partner
> contigs
> ok 46 - surjection of paired reads to SAM produces correct flags
> ok 47 - surjection of unpaired reads to SAM yields correct positions
> ok 48 - surjection of unpaired reads to SAM yields correct pair partner
> positions
> ok 49 - surjection of unpaired reads to SAM yields distinct QNAMEs
> ok 50 - surjection of unpaired reads to SAM produces absent partner contigs
> ok 51 - surjection of unpaired reads to SAM produces correct flags
> ok 52 - mapper can read FASTA input
> ok 53 - mapper can read multiline FASTA input
> ok 54 - xdrop works on a reversed read
> Failed 1/54 subtests
> t/08_vg_ids.t .........
> 1..10
> ok 1 - minimum node as expected (id compaction correct)
> ok 2 - maximum node is as expected (id compaction correct)
> ok 3 - correctly generated joint id space for several graphs
> ok 4 - can sort and re-number a graph with self loops
> ok 5 - can sort and renumber a complex cyclic graph
> ok 6 - sorting removes back-edges in a DAG
> ok 7 - sorting assigns node IDs in topological order
> ok 8 - sorting does not affect id range
> ok 9 - sorting does not affect id range of vg
> ok 10 - sorting does not affect id range of hg
> ok
> t/09_vg_concat.t ......
> 1..4
> ok 1 - concat doubles the number of nodes
> ok 2 - concat doubles the number of edges + 1
> ok 3 - concat -p doubles the number of nodes on reversing graph
> ok 4 - concat -p doubles the number of edges + 1 on reversing graph
> ok
> t/100_code_quality.t ..
> 1..1
> ok 1 - code quality is acceptable
> ok
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping
> variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS
>
> AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL
> !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping
> variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100
> PASS
> AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null
> !
> warning:[vg::Constructor] Unsupported variant allele "<CN2>"; Skipping
> variant(s) z 490168 DUP_gs_CNV_20_1490168_1549769 G <CN2> 100
> PASS
> AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CS=DUP_gs;DP=21874;EAS_AF=0;END=1549769;EUR_AF=0;NS=2504;SAS_AF=0.001;SVTYPE=DUP
> !
> t/10_vg_stats.t .......
> 1..11
> ok 1 - vg stats reports the expected number of nodes
> ok 2 - vg stats reports the expected number of edges
> ok 3 - vg stats reports the expected graph length
> ok 4 - vg stats reports the correct number of subgraphs
> ok 5 - vg stats reports the correct subgraph length
> ok 6 - distance to head is correct
> ok 7 - distance to tail is correct
> ok 8 - aligned read stats are computed correctly
> ok 9 - basic stats agree between graph formats
> ok 10 - stats can be computed for GAM files without graphs
> ok 11 - a path overlap description of a test graph has the expected length
> ok
> t/11_vg_paths.t .......
> 1..13
> ok 1 - path listing works from vg
> ok 2 - path listing works from XG
> ok 3 - thread listing works from GBWT
> ok 4 - thread selection by name prefix works correctly
> ok 5 - thread selection by sample name works correctly
> ok 6 - no threads are reported for invalid samples
> ok 7 - vg paths may be used to extract threads
> ok 8 - Fasta extracted from xg is the same as the input fasta
> ok 9 - Fasta extracted from vg is the same as the input fasta
> ok 10 - Fasta extracted from threads has correct number of lines
> ok 11 - a single path may be retained
> ok 12 - path filtering does not modify the graph
> ok 13 - alt allele paths can be dropped
> ok
> warning[vg mod]: -o is deprecated. Dangling edges are now automatically
> removed.
> t/12_vg_kmers.t .......
> 1..10
> ok 1 - correct numbers of kmers in the graph
> ok 2 - to_end edges are handled correctly
> ok 3 - from_start edges are handled correctly
> ok 4 - GCSA2 output produces the expected number of lines
> ok 5 - GCSA2 binary output produces the expected number bytes
> ok 6 - GCSA2 output works when next position is multiple
> ok 7 - GCSA2 output works when previous characters are multiple
> ok 8 - edge-max correctly bounds the number of kmers in a complex graph
> ok 9 - start/stop node IDs can be specified in GCSA2 output
> ok 10 - attempting to generate kmers longer than the longest path in a graph
> correctly yields no kmers
> ok
> index file n.fa.fai not found, generating...
> t/13_vg_sim.t .........
> 1..18
> ok 1 - vg sim creates the correct number of reads
> ok 2 - end bonuses are included
> ok 3 - alignments may be generated rather than read sequences
> ok 4 - alignments are produced on both strands
> ok 5 - high simulated error rates do not change the number of bases generated
> ok 6 - vg sim creates forward-strand reads when asked
> ok 7 - vg sim can simulate from just a path
> ok 8 - vg sim can simulate from just a path in FASTQ mode
> ok 9 - reads can be simulated from all paths
> ok 10 - simulation was successful
> ok 11 - reads can be simulated from GBWT samples
> ok 12 - simulation was successful
> ok 13 - pairs simulated even when fragments overlap
> ok 14 - sim does not emit reads with Ns
> ok 15 - sim can emit reads with Ns when asked to
> ok 16 - sim doesn't emit Ns even with pair and errors
> ok 17 - ngs trained simulator works
> ok 18 - ngs trained simulator generates gam
> ok
> warning[load_proto_to_graph]: dangling edges on missing node 199474497 and 2
> other missing nodes removed
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 95
> [algorithms::normalize] iteration 2 current length 95
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 5
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 5
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 106
> [algorithms::normalize] iteration 2 current length 105
> [algorithms::normalize] iteration 3 current length 105
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 103
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] iteration 3 current length 100
> [algorithms::normalize] normalized in 2 steps
> t/14_vg_mod.t .........
> 1..32
> ok 1 - vg mod yields a graph with only a particular path
> ok 2 - orphan edge removal is automatic
> ok 3 - graph complexity reduction works as expected
> ok 4 - short subgraph pruning works
> ok 5 - normalization produces the correct number of nodes
> ok 6 - normalization removes redundant SNP alleles
> ok 7 - normalization produces a valid graph
> ok 8 - looped normalization produces a valid graph
> ok 9 - unchop produces a valid graph
> ok 10 - normalization removes redundant sequence in the graph
> ok 11 - normalization doesn't introduce cycles and does remove redundancy in
> bubbles
> ok 12 - vg mod removes non-path nodes and edge
> ok 13 - chopping a graph works correctly with reverse mappings
> ok 14 - unchop correctly handles paths
> ok 15 - unchop correctly handles a graph with an inversion
> ok 16 - unchop handles doubly-reversing edges
> ok 17 - normalization works on a graph with an inversion
> ok 18 - mod successfully unchops a difficult graph
> ok 19 - chopping self-cycling nodes retains the cycle
> ok 20 - unrolling works and produces a valid graph
> ok 21 - unfolding works and produces a valid graph
> ok 22 - dagify-unroll produces a graph with the same kmers as the original
> graph
> ok 23 - unfold produces a graph with the same kmers as the original graph
> ok 24 - dagify handles a graph with two strongly connected components
> ok 25 - unfold followed by dagify produces a graph with no cycles
> ok 26 - unfold followed by dagify produces a graph with the same kmers as the
> original graph
> ok 27 - dagify unrolls the un-unrollable graph
> ok 28 - sibling simplification does not disrupt paths
> ok 29 - dagify correctly calculates the minimum distance through the unrolled
> component
> ok 30 - dagify produces a graph of the correct size
> ok 31 - subsetting a flat-alleles graph to a sample graph works
> ok 32 - removal of high-degree nodes results in the expected number of
> subgraphs
> ok
> t/15_vg_surject.t .....
> 1..27
> ok 1 - reads are generated
> ok 2 - vg surject works perfectly for perfect reads without misaligned
> homopolymer indels derived from the reference
> ok 3 - vg surject actually places reads on the correct path
> ok 4 - vg surject doesn't need to be told which path to use
> ok 5 - vg surject works for every read simulated from a dense graph
> ok 6 - vg surject spliced algorithm works for every read simulated from a
> dense graph
> ok 7 - vg surject produces valid SAM output
> ok 8 - vg map may surject reads to produce valid SAM output
> ok 9 - vg map may surject reads to produce valid BAM output
> ok 10 - vg surject retains read names
> ok 11 - vg surject can set sample and read group
> ok 12 - we respect the original mapping's softclips
> ok 13 - forward and reverse orientations of a read produce the same surjected
> SAM, ignoring flags
> ok 14 - vg surject produces valid BAM output
> ok 15 - mapping quality is preserved through surjection
> ok 16 - read pairing is preserved through GAM->GAM surjection
> ok 17 - surjection of paired reads to SAM yields correct positions
> ok 18 - surjection of paired reads to SAM yields correct pair partner
> positions
> ok 19 - surjection of paired reads to SAM yields properly matched QNAMEs
> ok 20 - surjection of paired reads to SAM produces correct pair partner
> contigs
> ok 21 - surjection of paired reads to SAM produces correct flags
> ok 22 - surjection of paired reads to SAM tags both reads with a read group
> ok 23 - surjection of paired reads to SAM creates RG header
> ok 24 - surjection works for a longer (151bp) read
> ok 25 - surjection works for another difficult read
> ok 26 - mapping reproduces qualities from BAM input
> ok 27 - mapping reproduces qualities from fastq input
> ok
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] normalized in 0 steps
> could not open msgas/t.fa
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::PathHandleGraph
> could not open msgas/t.fa
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading
> handlegraph::PathHandleGraph
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> index file msgas/s-rev.fa.fai not found, generating...
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] normalized in 0 steps
> index file GRCh38_alts/FASTA/HLA/K-3138.fa.fai not found, generating...
> index file msgas/inv.fa.fai not found, generating...
> [algorithms::normalize] iteration 1 current length 210
> [algorithms::normalize] iteration 2 current length 210
> [algorithms::normalize] normalized in 1 steps
> index file GRCh38_alts/FASTA/HLA/B-3106.fa.fai not found, generating...
> t/16_vg_msga.t ........
> 1..14
> ok 1 - MSGA produces the expected graph for GRCh38 HLA-V
> ok 2 - X-drop DP MSGA produces the expected graph for GRCh38 HLA-V
> {"edge": [{"from": "5", "from_start": true, "to": "6", "to_end": true},
> {"from": "5", "from_start": true, "to": "7", "to_end": true}, {"from": "6",
> "to": "7"}], "node": [{"id": "5", "sequence": "GGACTAAGGACAAAGGTGCGGGGAG"},
> {"id": "7", "sequence": "AACTACTCCACATCAAAGCTACCCAGGCCATTTTAAGTTTCCTGT"},
> {"id": "6", "sequence": "TCAGATTCTCATCCCTCCTCAAGGGCTTCT"}], "path":
> [{"mapping": [{"edit": [{"from_length": 30, "to_length": 30}], "position":
> {"node_id": "6"}, "rank": "1"}, {"edit": [{"from_length": 45, "to_length":
> 45}], "position": {"node_id": "7"}, "rank": "2"}, {"edit": [{"from_length":
> 25, "to_length": 25}], "position": {"node_id": "5"}, "rank": "3"}], "name":
> "s1"}, {"mapping": [{"edit": [{"from_length": 30, "to_length": 30}],
> "position": {"node_id": "6"}, "rank": "1"}, {"edit": [{"from_length": 25,
> "to_length": 25}], "position": {"node_id": "5"}, "rank": "2"}], "name":
> "s2"}]}
> ok 3 - soft clips at node boundaries (start) are included correctly
> ok 4 - soft clips at node boundaries (end) are included correctly
> ok 5 - region hints (-p) produce same graph
> ok 6 - adding in existing sequences in reverse doesn't change graph
> ok 7 - the paths of the graph encode the original sequences used to build it
> ok 8 - even when banding the paths of the graph encode the original sequences
> used to build it
> ok 9 - HLA K-3138 correctly includes all input paths
> ok 10 - a difficult cyclic path can be included to produce a valid graph
> ok 11 - a reference sequence set representing an inversion in it may be
> msga'd and detected
> ok 12 - edges in cycles with two nodes are correctly included
> ok 13 - HLA B-3106 is assembled into a valid graph
> ok 14 - odd-sized overlaps may be used for chunked alignment
> ok
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> warning: when streaming in a GAM with -A, the output GAM will
> lose all non-Path related fields from the input
> t/17_vg_augment.t: line 50: jq.: command not found
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is
> recommended to pass in a filename rather than - so it can be streamed over
> two passes
> t/17_vg_augment.t .....
> 1..37
> ok 1 - direct augmentation embeds reads fully for well-supported SNPs
> ok 2 - adding a well-supported SNP by direct augmentation adds 3 more nodes
> ok 3 - adding a well-supported SNP by direct augmentation adds 3 more nodes
> with -m 1
> ok 4 - direct augmentation embeds reads fully for probable errors
> ok 5 - adding a probable error by direct augmentation adds 3 more nodes
> ok 6 - path inclusion does not modify the graph when alignment is a perfect
> match
> ok 7 - path inclusion does not modify the graph when alignment has a SNP but
> doesnt meet the coverage threshold
> ok 8 - path inclusion does not modify the included path when alignment has a
> SNP but doesnt meet the coverage threshold
> ok 9 - 0
> ok 10 - path inclusion with a complex variant introduces the right number of
> nodes
> ok 11 - path inclusion works for deletions
> ok 12 - SNPs can be included in the graph
> ok 13 - a soft clip at read start becomes a new head of the graph
> ok 14 - a soft clip at read end becomes a new tail of the graph
> ok 15 - augment -s works as desired
> ok 16 - the expected graph translation is exported when the graph is edited
> ok 17 - editing the graph with many SNP-containing alignments does not
> introduce duplicate identical nodes
> ok 18 - augmenting 2 snps with -m 1 produces the same nodes as default
> ok 19 - augmenting 2 snps and 2 errors with -m 11 produces the same nodes as
> with just the snps
> ok 20 - augmenting with 2snps makes correct number of nodes
> ok 21 - low-quality snp is filtered
> ok 22 - augmenting a packed graph produces same results as a vg graph
> ok 23 - augmenting a hash graph produces same results as a vg graph
> ok 24 - augmenting between nodes without filters works as expected
> ok 25 - augmenting between nodes with inactive filters works as expected
> ok 26 - augmenting between nodes N filter works as expected
> ok 27 - augmenting between nodes without filters works as expected on reverse
> strand
> ok 28 - augmenting between nodes with inactive filters works as expected on
> reverse strand
> ok 29 - augmenting between nodes N filter works as expected on reverse strand
> ok 30 - augmenting within node without filters works as expected
> ok 31 - augmenting within node with inactive filters works as expected
> ok 32 - augmenting within node with N filter works as expected
> ok 33 - augmenting within node without filters works as expected on reverse
> strand
> ok 34 - augmenting within node with inactive filters works as expected on
> reverse strand
> ok 35 - augmenting within node with N filter works as expected on reverse
> strand
> ok 36 - sequence in filtered alignment has removed insertion
> ok 37 - sequence in filtered alignment has removed insertion on reverse strand
> ok
> index file inverting/miniFasta.fa.fai not found, generating...
> index file m.fa.fai not found, generating...
> t/18_vg_call.t ........
> 1..9
> ok 1 - calling empty gam gives empty VCF
> ok 2 - Called microinversion
> ok 3 - Called no microinversion with haploid setting
> ok 4 - Fewer than 8 differences between called and true SV genotypes
> ok 5 - Fewer than 8 differences between called haploid and truncated true SV
> genotypes
> ok 6 - call output same on vg as xg
> ok 7 - call output same on vg as xg
> ok 8 - vg call finds true homozygous variants in a cyclic graph
> ok 9 - vg call finds same variants when using gbwt to enumerate traversals
> ok
> t/19_vg_compare.t ..... skipped: (no reason given)
> rapper: Parsing file <stdin> with parser turtle and base URI
> http://example.org/vg
> rapper: Parsing returned 85 triples
> rapper: Parsing file <stdin> with parser turtle and base URI
> http://example.org/vg
> rapper: Parsing returned 75 triples
> t/20_vgtordf.t ........
> 1..6
> ok 1 - vg view produces the expected number of lines of turtle
> ok 2 - vg view produces the expected number of lines of turtle
> ok 3 - rapper passed
> ok 4 - rapper passed
> ok 5 - vg view produces the expected number of lines of turtle
> ok 6 - vg view produces the expected number of lines of turtle
> ok
> t/21_vg_filter.t ......
> 1..10
> ok 1 - vg filter with no options preserves input.
> ok 2 - vg filter downsamples correctly
> ok 3 - samtools 1.0+ and vg filter agree on how to select downsampled paired
> reads
> ok 4 - samtools 1.0+ and vg filter agree on how to select downsampled
> unpaired reads
> ok 5 - reads with refpos annotations not matching an exclusion regex are let
> through
> ok 6 - reads with refpos annotations matching an exclusion regex are removed
> ok 7 - negating a non-filter results in no reads
> ok 8 - a filter and its complement should form the entire file
> ok 9 - read pairs can be tropped by feature
> ok 10 - read pairs can be kept if only one read fails
> ok
> t/22_ggsv.t ........... skipped: (no reason given)
> t/23_vectorize.t ...... skipped: (no reason given)
> t/25_circularize.t ....
> 1..2
> ok 1 - a path may be circularized
> ok 2 - a circular path survives a round trip to/from xg
> ok
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> graph path 'alt2.3' invalid: edge from 15 end to 1 start does not exist
> [vg view] warning: graph is invalid!
> t/26_deconstruct.t ....
> 1..19
> ok 1 - deconstruct retrieved original VCF (modulo adjacent snp allele)
> ok 2 - deconstructed hla vcf has correct number of sites
> ok 3 - deconstructed hla vcf has correct insertion
> ok 4 - deconstructed hla vcf with other path has correct number of sites
> ok 5 - deconstructed hla vcf has correct deletion
> ok 6 - path-based and exhaustive decontruction give equivalent sites when
> expected
> ok 7 - path that differs from reference in every alt has correct genotype
> ok 8 - path that is same as reference in every alt has correct genotype
> ok 9 - reference contig correctly written
> ok 10 - deconstruct correctly handles a simple inversion
> ok 11 - deconstruct correctly handles a simple inversion when the reference
> contains the reversing edge
> ok 12 - deconstruct correctly handles a cycle in the reference path when
> contained inside snarl
> ok 13 - deconstruct correctly handles a cycle in the alt path
> ok 14 - cyclic reference deconstruction has correct number of variants
> ok 15 - deconstruct correctly handles cycle in the reference path that spans
> snarl
> ok 16 - -P -A options return correct number of variants
> ok 17 - -P -A options use correct reference name
> ok 18 - -P -A identifies conflict in alt1 in second variant
> ok 19 - deconstructing vg graph gives same output as xg graph
> ok
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 4
> Snarl length distribution:
> 2 1
> 1 3
> index file flat1.fa.fai not found, generating...
> index file flat2.fa.fai not found, generating...
> Statistics:
> Number of Non-Degenerate Snarls: 8
> Snarls traversed by reads: 8
> Snarls on reference: 0
> Snarl length distribution:
> index file flats.fa.fai not found, generating...
> Warning: realigned read CCTACAGACATA doesn't touch either end of its snarl!
> Warning: realigned read TTACAATGAGCC doesn't touch either end of its snarl!
> Warning: realigned read CCCTACAGACAT doesn't touch either end of its snarl!
> Warning: realigned read GTTACAATGAGC doesn't touch either end of its snarl!
> Warning: realigned read GCCCTACAGACA doesn't touch either end of its snarl!
> Warning: realigned read CTCATTGTAACG doesn't touch either end of its snarl!
> Warning: realigned read TACAGACATATC doesn't touch either end of its snarl!
> Warning: realigned read TGAGCCCTACAG doesn't touch either end of its snarl!
> Warning: realigned read TAGGGCTCATTG doesn't touch either end of its snarl!
> Warning: realigned read GAGCCCTACAGA doesn't touch either end of its snarl!
> Warning: realigned read TGTCTGTAGGGC doesn't touch either end of its snarl!
> Warning: realigned read ACGTTACAATGA doesn't touch either end of its snarl!
> Warning: realigned read GCTCATTGTAAC doesn't touch either end of its snarl!
> Warning: realigned read AGGGCTCATTGT doesn't touch either end of its snarl!
> Warning: realigned read TGTCTGTAGGGC doesn't touch either end of its snarl!
> Warning: realigned read GTAGGGCTCATT doesn't touch either end of its snarl!
> Warning: realigned read GTCTGTAGGGCT doesn't touch either end of its snarl!
> Warning: realigned read ACGTTACAATGA doesn't touch either end of its snarl!
> Warning: realigned read TACAATGAGCCC doesn't touch either end of its snarl!
> Warning: realigned read GGGCTCATTGTA doesn't touch either end of its snarl!
> Warning: realigned read CTGTAGGGCTCA doesn't touch either end of its snarl!
> Warning: realigned read TATGTCTGTAGG doesn't touch either end of its snarl!
> Warning: realigned read GCTCATTGTAAC doesn't touch either end of its snarl!
> Warning: realigned read CTGTAGGGCTCA doesn't touch either end of its snarl!
> Warning: realigned read TACAATGAGCCC doesn't touch either end of its snarl!
> Statistics:
> Number of Non-Degenerate Snarls: 1
> Snarls traversed by reads: 1
> Snarls on reference: 1
> Snarl length distribution:
> 0 1
> t/27_vg_genotype.t ....
> 1..5
> ok 1 - vg genotype runs successfully
> ok 2 - vg genotype runs successfully when emitting vcf
> ok 3 - called genotypes are correct in a small simulated example
> ok 4 - genotype format can be converted to and from JSON
> ok 5 - genotype finds big insert
> ok
> [algorithms::normalize] iteration 1 current length 58
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 58
> [algorithms::normalize] normalized in 0 steps
> t/28_translate.t ......
> 1..2
> ok 1 - alignments used to modify a graph may be projected back to the
> original graph and used to regenerate the same graph
> ok 2 - translation overlay works and produces a sane result
> ok
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> t/29_vg_locify.t ......
> 1..9
> ok 1 - locify produces output for each input alignment
> ok 2 - the sorted list of loci has one locus per snarl
> ok 3 - the first locus is as expected
> ok 4 - a middle locus is as expected
> ok 5 - the last locus is as expected
> ok 6 - limitation to 2-best works
> ok 7 - limitation to 3-best works
> ok 8 - limitation to 4-best works
> ok 9 - we always get one allele when all the reads match the graph
> ok
> [vg] warning: node ID 44 appears multiple times. Skipping.
> [vg] warning: node ID 45 appears multiple times. Skipping.
> [vg] warning: node ID 43 appears multiple times. Skipping.
> [vg] warning: edge 43 end <-> 44 start appears multiple times. Skipping.
> [vg] warning: edge 43 end <-> 45 start appears multiple times. Skipping.
> [vg] warning: node ID 87 appears multiple times. Skipping.
> [vg] warning: node ID 88 appears multiple times. Skipping.
> [vg] warning: node ID 85 appears multiple times. Skipping.
> [vg] warning: node ID 86 appears multiple times. Skipping.
> [vg] warning: edge 87 end <-> 88 start appears multiple times. Skipping.
> [vg] warning: edge 85 end <-> 87 start appears multiple times. Skipping.
> [vg] warning: edge 85 end <-> 86 start appears multiple times. Skipping.
> [vg] warning: edge 86 end <-> 88 start appears multiple times. Skipping.
> [vg] warning: node ID 130 appears multiple times. Skipping.
> [vg] warning: node ID 131 appears multiple times. Skipping.
> [vg] warning: node ID 129 appears multiple times. Skipping.
> [vg] warning: edge 130 end <-> 131 start appears multiple times. Skipping.
> [vg] warning: edge 129 end <-> 130 start appears multiple times. Skipping.
> [vg] warning: edge 129 end <-> 131 start appears multiple times. Skipping.
> [vg] warning: node ID 173 appears multiple times. Skipping.
> [vg] warning: node ID 174 appears multiple times. Skipping.
> [vg] warning: node ID 172 appears multiple times. Skipping.
> [vg] warning: edge 173 end <-> 174 start appears multiple times. Skipping.
> [vg] warning: edge 172 end <-> 173 start appears multiple times. Skipping.
> [vg] warning: edge 172 end <-> 174 start appears multiple times. Skipping.
> Restricting to x from 1 to end
> Restricting to y from 1 to end
> t/30_vg_chunk.t .......
> 1..24
> ok 1 - vg chunk with no options preserves nodes
> ok 2 - vg chunk with no options preserves edges
> ok 3 - chunk has path going through node 9
> ok 4 - chunk has path going through node 9
> ok 5 - -s produces correct number of chunks
> ok 6 - gam chunker produces correct number of graphs
> ok 7 - gam chunker produces correct number of gams
> ok 8 - gam chunker produces bed with correct number of chunks
> ok 9 - gam chunker emits each matching read at most once
> ok 10 - chunk contains the expected number of alignments
> ok 11 - id chunker produces correct chunk size
> ok 12 - id chunker produces correct single chunk
> ok 13 - id chunker traces correct chunk size
> ok 14 - chunker extracts no threads from an empty gPBWT
> ok 15 - chunker extracts 2 local threads from a gBWT with 2 locally distinct
> threads in it
> ok 16 - chunker can extract a partial haplotype from a GBWT
> ok 17 - n-chunking works and chunks over the full graph
> ok 18 - path-based components finds subgraphs
> ok 19 - x gam chunk has correct number of reads
> ok 20 - y gam chunk has correct number of reads
> ok 21 - x gam chunk has correct number of reads with -p path
> ok 22 - y gam chunk has correct number of reads with -p path
> ok 23 - path-based component contains correct path length
> ok 24 - components finds subgraphs
> ok
> index file add/ref.fa.fai not found, generating...
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs
> average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 1: 3 haplotypes at chrR:18: 32 bp vs. 33 bp haplotypes vs. graphs
> average
> Variant 2: 3 haplotypes at chrR:21: 32 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 3: 3 haplotypes at chrR:23: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs
> average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 1: 4 haplotypes at ref:2: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 2: 4 haplotypes at ref:21: 33 bp vs. 36 bp haplotypes vs. graphs
> average
> Variant 3: 4 haplotypes at ref:32: 33 bp vs. 36 bp haplotypes vs. graphs
> average
> index file add/refN.fa.fai not found, generating...
> Variant 1: 4 haplotypes at ref:2: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 2: 4 haplotypes at ref:21: 33 bp vs. 36 bp haplotypes vs. graphs
> average
> Variant 3: 4 haplotypes at ref:32: 33 bp vs. 36 bp haplotypes vs. graphs
> average
> index file add/ngap.fa.fai not found, generating...
> Variant 1: 2 haplotypes at ngap:10923: 224 bp vs. 224 bp haplotypes vs.
> graphs average
> Variant 2: 5 haplotypes at ngap:11014: 256 bp vs. 258 bp haplotypes vs.
> graphs average
> Variant 3: 5 haplotypes at ngap:11030: 256 bp vs. 261 bp haplotypes vs.
> graphs average
> Variant 4: 5 haplotypes at ngap:11035: 256 bp vs. 261 bp haplotypes vs.
> graphs average
> Variant 5: 5 haplotypes at ngap:11043: 256 bp vs. 261 bp haplotypes vs.
> graphs average
> Variant 1: 2 haplotypes at x:9: 160 bp vs. 161 bp haplotypes vs. graphs
> average
> Variant 2: 2 haplotypes at x:10: 160 bp vs. 167 bp haplotypes vs. graphs
> average
> Variant 3: 2 haplotypes at x:14: 160 bp vs. 167 bp haplotypes vs. graphs
> average
> Variant 4: 2 haplotypes at x:34: 160 bp vs. 167 bp haplotypes vs. graphs
> average
> Variant 5: 2 haplotypes at x:39: 160 bp vs. 167 bp haplotypes vs. graphs
> average
> Variant 6: 2 haplotypes at x:52: 224 bp vs. 231 bp haplotypes vs. graphs
> average
> Variant 7: 2 haplotypes at x:58: 224 bp vs. 232 bp haplotypes vs. graphs
> average
> Variant 8: 2 haplotypes at x:100: 256 bp vs. 265 bp haplotypes vs. graphs
> average
> Variant 9: 2 haplotypes at x:103: 256 bp vs. 267 bp haplotypes vs. graphs
> average
> Variant 10: 2 haplotypes at x:122: 288 bp vs. 299 bp haplotypes vs. graphs
> average
> Variant 11: 2 haplotypes at x:142: 288 bp vs. 301 bp haplotypes vs. graphs
> average
> Variant 12: 2 haplotypes at x:160: 306 bp vs. 319 bp haplotypes vs. graphs
> average
> Variant 13: 2 haplotypes at x:172: 338 bp vs. 353 bp haplotypes vs. graphs
> average
> Variant 14: 2 haplotypes at x:178: 313 bp vs. 327 bp haplotypes vs. graphs
> average
> Variant 15: 2 haplotypes at x:187: 313 bp vs. 327 bp haplotypes vs. graphs
> average
> Variant 16: 2 haplotypes at x:200: 294 bp vs. 306 bp haplotypes vs. graphs
> average
> Variant 17: 2 haplotypes at x:204: 294 bp vs. 306 bp haplotypes vs. graphs
> average
> Variant 18: 2 haplotypes at x:218: 288 bp vs. 300 bp haplotypes vs. graphs
> average
> Variant 19: 2 haplotypes at x:221: 288 bp vs. 300 bp haplotypes vs. graphs
> average
> Variant 20: 2 haplotypes at x:272: 256 bp vs. 266 bp haplotypes vs. graphs
> average
> Variant 21: 2 haplotypes at x:277: 256 bp vs. 272 bp haplotypes vs. graphs
> average
> Variant 22: 2 haplotypes at x:287: 256 bp vs. 272 bp haplotypes vs. graphs
> average
> Variant 23: 2 haplotypes at x:294: 256 bp vs. 272 bp haplotypes vs. graphs
> average
> Variant 24: 2 haplotypes at x:297: 291 bp vs. 305 bp haplotypes vs. graphs
> average
> Variant 25: 2 haplotypes at x:312: 323 bp vs. 340 bp haplotypes vs. graphs
> average
> Variant 26: 2 haplotypes at x:313: 323 bp vs. 341 bp haplotypes vs. graphs
> average
> Variant 27: 2 haplotypes at x:345: 291 bp vs. 306 bp haplotypes vs. graphs
> average
> Variant 28: 2 haplotypes at x:347: 323 bp vs. 339 bp haplotypes vs. graphs
> average
> Variant 29: 2 haplotypes at x:353: 311 bp vs. 326 bp haplotypes vs. graphs
> average
> Variant 30: 2 haplotypes at x:373: 291 bp vs. 306 bp haplotypes vs. graphs
> average
> Variant 31: 2 haplotypes at x:397: 288 bp vs. 307 bp haplotypes vs. graphs
> average
> Variant 32: 2 haplotypes at x:398: 288 bp vs. 307 bp haplotypes vs. graphs
> average
> Variant 33: 2 haplotypes at x:405: 241 bp vs. 258 bp haplotypes vs. graphs
> average
> Variant 34: 2 haplotypes at x:408: 241 bp vs. 258 bp haplotypes vs. graphs
> average
> Variant 35: 2 haplotypes at x:466: 254 bp vs. 260 bp haplotypes vs. graphs
> average
> Variant 36: 2 haplotypes at x:474: 286 bp vs. 295 bp haplotypes vs. graphs
> average
> Variant 37: 2 haplotypes at x:489: 286 bp vs. 296 bp haplotypes vs. graphs
> average
> Variant 38: 2 haplotypes at x:500: 286 bp vs. 297 bp haplotypes vs. graphs
> average
> Variant 39: 2 haplotypes at x:523: 300 bp vs. 309 bp haplotypes vs. graphs
> average
> Variant 40: 2 haplotypes at x:533: 289 bp vs. 299 bp haplotypes vs. graphs
> average
> Variant 41: 1 haplotypes at x:553: 257 bp vs. 263 bp haplotypes vs. graphs
> average
> Variant 42: 1 haplotypes at x:566: 257 bp vs. 263 bp haplotypes vs. graphs
> average
> Variant 43: 2 haplotypes at x:629: 277 bp vs. 281 bp haplotypes vs. graphs
> average
> Variant 44: 2 haplotypes at x:647: 278 bp vs. 285 bp haplotypes vs. graphs
> average
> Variant 45: 2 haplotypes at x:654: 278 bp vs. 287 bp haplotypes vs. graphs
> average
> Variant 46: 2 haplotypes at x:668: 310 bp vs. 320 bp haplotypes vs. graphs
> average
> Variant 47: 2 haplotypes at x:669: 310 bp vs. 321 bp haplotypes vs. graphs
> average
> Variant 48: 2 haplotypes at x:681: 289 bp vs. 299 bp haplotypes vs. graphs
> average
> Variant 49: 2 haplotypes at x:688: 289 bp vs. 299 bp haplotypes vs. graphs
> average
> Variant 50: 2 haplotypes at x:698: 280 bp vs. 289 bp haplotypes vs. graphs
> average
> Variant 51: 2 haplotypes at x:714: 299 bp vs. 307 bp haplotypes vs. graphs
> average
> Variant 52: 2 haplotypes at x:757: 287 bp vs. 299 bp haplotypes vs. graphs
> average
> Variant 53: 2 haplotypes at x:775: 273 bp vs. 285 bp haplotypes vs. graphs
> average
> Variant 54: 2 haplotypes at x:777: 273 bp vs. 286 bp haplotypes vs. graphs
> average
> Variant 55: 2 haplotypes at x:789: 273 bp vs. 287 bp haplotypes vs. graphs
> average
> Variant 56: 2 haplotypes at x:795: 273 bp vs. 287 bp haplotypes vs. graphs
> average
> Variant 57: 2 haplotypes at x:813: 287 bp vs. 300 bp haplotypes vs. graphs
> average
> Variant 58: 2 haplotypes at x:823: 287 bp vs. 302 bp haplotypes vs. graphs
> average
> Variant 59: 2 haplotypes at x:827: 319 bp vs. 334 bp haplotypes vs. graphs
> average
> Variant 60: 2 haplotypes at x:858: 297 bp vs. 310 bp haplotypes vs. graphs
> average
> Variant 61: 2 haplotypes at x:859: 297 bp vs. 312 bp haplotypes vs. graphs
> average
> Variant 62: 2 haplotypes at x:860: 297 bp vs. 312 bp haplotypes vs. graphs
> average
> Variant 63: 2 haplotypes at x:877: 287 bp vs. 303 bp haplotypes vs. graphs
> average
> Variant 64: 2 haplotypes at x:888: 244 bp vs. 262 bp haplotypes vs. graphs
> average
> Variant 65: 2 haplotypes at x:899: 243 bp vs. 263 bp haplotypes vs. graphs
> average
> Variant 66: 2 haplotypes at x:901: 243 bp vs. 264 bp haplotypes vs. graphs
> average
> Variant 67: 2 haplotypes at x:916: 224 bp vs. 243 bp haplotypes vs. graphs
> average
> Variant 68: 2 haplotypes at x:917: 224 bp vs. 243 bp haplotypes vs. graphs
> average
> Variant 69: 2 haplotypes at x:923: 223 bp vs. 243 bp haplotypes vs. graphs
> average
> Variant 70: 2 haplotypes at x:925: 223 bp vs. 243 bp haplotypes vs. graphs
> average
> Variant 71: 2 haplotypes at x:929: 222 bp vs. 242 bp haplotypes vs. graphs
> average
> Variant 72: 2 haplotypes at x:939: 204 bp vs. 223 bp haplotypes vs. graphs
> average
> Variant 73: 2 haplotypes at x:945: 204 bp vs. 223 bp haplotypes vs. graphs
> average
> Variant 74: 2 haplotypes at x:972: 177 bp vs. 194 bp haplotypes vs. graphs
> average
> Variant 75: 2 haplotypes at x:1000: 136 bp vs. 149 bp haplotypes vs. graphs
> average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs
> average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs
> average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs
> average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs
> average
> t/31_vg_add.t .........
> 1..11
> ok 1 - vg add can create a graph
> ok 2 - vg add can create a graph with contig renames
> ok 3 - vg add produces the same graph from VCFs with different contig names
> ok 4 - vg add can create a graph from a PackedGraph
> ok 5 - vg add produces the same graph from the same input in different formats
> ok 6 - having reference Ns does not affect the graph topology
> ok 7 - adding variants adds only the alt bases near large N gaps
> ok 8 - vg add can create a slightly larger graph
> ok 9 - ranks are calculated for emitted paths
> ok 10 - graphs with backward nodes can be added to
> ok 11 - graphs with backward and forward nodes can be added to
> ok
> Restricting to x from 1 to end
> Restricting to y from 1 to end
> t/32_vg_snarls.t ......
> 1..9
> ok 1 - vg snarls made right number of protobuf Snarls
> ok 2 - vg snarls made right number of protobuf SnarlTraversals
> ok 3 - vg snarls on xg made right number of protobuf Snarls
> ok 4 - vg snarls on xg made right number of protobuf SnarlTraversals
> ok 5 - vcf traversals are the same as exhaustive traversals for tiny graph
> ok 6 - vcf traversals are the same as exhaustive traversals for inversion
> ok 7 - vcf traversals are the same as exhaustive traversals for ins_and_del
> graph
> ok 8 - correct number of snarls when parallelizing on compoents
> ok 9 - same number of snarls when parallelizing on components
> ok
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -f
> reads/xy2.match.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.match.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa
> --gbwt-name xy2.gbwt -f reads/xy2.match.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Mapping reads from reads/xy2.match.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -I 200 -D 200 -x xy2.xg -g
> xy2.gcsa -f reads/xy2.matchpaired.fq -i -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.matchpaired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -I 200 -D 200 -x xy2.xg -g
> xy2.gcsa --gbwt-name xy2.gbwt -f reads/xy2.matchpaired.fq -i -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Mapping reads from reads/xy2.matchpaired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> warning:[vg mpmap] Snarl file (-s) is ignored in single path mode (-S)
> without multipath population scoring (--max-paths).
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -s
> xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> warning:[vg mpmap] Snarl file (-s) is ignored in single path mode (-S)
> without multipath population scoring (--max-paths).
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -s
> xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa
> --gbwt-name xy2.gbwt -s xy2.snarls -f reads/xy2.discordant.fq -t 1 -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Loading snarls from xy2.snarls
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 1 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa
> --gbwt-name xy2.gbwt -s xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Loading snarls from xy2.snarls
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g
> graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -I 10
> -D 50 -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g
> graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -I
> 100000 -D 5 -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g
> graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> warning:[vg mpmap] Could not find 1000 (-b) unambiguous read pair mappings to
> estimate fragment length ditribution. This can happen due to data issues
> (e.g. unpaired reads being mapped as pairs) or because the sample size is too
> large for the read set. Mapping read pairs as independent single-ended reads.
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -x graphs/refonly-lrc_kir.vg.xg -g
> graphs/refonly-lrc_kir.vg.gcsa -G input.gam -i --single-path-mode
> --no-qual-adjust
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from input.gam using 4 threads
> [vg mpmap] Mapping reads from input.gam
> warning:[vg mpmap] Could not find 1000 (-b) unambiguous read pair mappings to
> estimate fragment length ditribution. This can happen due to data issues
> (e.g. unpaired reads being mapped as pairs) or because the sample size is too
> large for the read set. Mapping read pairs as independent single-ended reads.
> [vg mpmap] Mapping finished. Mapped 1000 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -x t.xg -g t.gcsa -f t.fq
> [vg mpmap] Loading graph from t.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping
> use cases. PackedGraph may be selected if memory usage is too high. See `vg
> convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from t.gcsa
> [vg mpmap] Loading LCP from t.gcsa.lcp
> [vg mpmap] Mapping reads from t.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 3 reads.
> t/33_vg_mpmap.t .......
> 1..14
> ok 1 - MAPQ is 50% without haplotype info
> ok 2 - haplotype match can disambiguate
> ok 3 - MAPQ is 50% when paired without haplotype info
> ok 4 - haplotype match can disambiguate paired
> ok 5 - use of haplotype-aware mapping is recorded
> ok 6 - Haplotype-oblivious mapping places read on the wrong contig
> ok 7 - Haplotype-oblivious mapping places read with MAPQ of 50%
> ok 8 - Haplotype-aware mapping places read on the right contig
> ok 9 - Haplotype-aware mapping places read with MAPQ > 50%
> ok 10 - paired read alignments forced to be consistent have lower score than
> unrestricted alignments
> ok 11 - paired read alignments forced to be consistent are closer together in
> node id space than unrestricted alignments
> ok 12 - paired read alignments forced to be near each other are closer
> together in node id space than those forced to be far apart
> ok 13 - small batches are still all paired in the output
> ok 14 - multipath mapping works in scenarios that trigger branch point
> trimming
> ok
> t/34_vg_pack.t ........
> 1..16
> ok 1 - allele observation packing detects 2 SNPs
> ok 2 - pileup packs agree with graph coverage
> ok 3 - graph coverages are merged from multiple .cx indexes
> ok 4 - edit records are merged from multiple .cx indexes
> ok 5 - binned edit accumulation does not affect the result
> ok 6 - pack records are filtered by node id
> ok 7 - pack records are filtered by node id
> ok 8 - pack index merging produces the expected result
> ok 9 - pack index merging produces the expected result for edges
> ok 10 - pack computes the same total edge coverage as pileup
> ok 11 - pack stores the correct edge pileup to disk
> ok 12 - node packs on vg same as xg
> ok 13 - edge packs on vg same as xg
> ok 14 - node packs same on vg when using 3 threads as when using 1
> ok 15 - edge packs same on vg when using 2 threads as when using 1
> ok 16 - average node qualities are correct
> ok
> t/36_vg_annotate.t ....
> 1..7
> ok 1 - we can detect when reads contain non-reference variation
> ok 2 - vg annotate finds the right number of reads overlapping a feature
> ok 3 - all reads overlapping a feature fall on its node
> ok 4 - vg annotate finds no reads touching both of two distant features
> ok 5 - vg annotate shows reads having to go through one feature to get to
> another at the end
> ok 6 - vg annotate shows all reads overlapping a whole-reference-covering
> feature
> ok 7 - annotations derived from BED can span the end/start joins of circular
> paths
> ok
> t/37_vg_gbwt.t ........
> 1..42
> ok 1 - chromosome x: 2 threads
> ok 2 - chromosome x: 1 contig
> ok 3 - chromosome x: 2 haplotypes
> ok 4 - chromosome x: 1 sample
> ok 5 - chromosome x: 2 thread names
> ok 6 - chromosome x: 1 contig name
> ok 7 - chromosome x: 1 sample name
> ok 8 - chromosome y: 2 threads
> ok 9 - chromosome y: 1 contig
> ok 10 - chromosome y: 2 haplotypes
> ok 11 - chromosome y: 1 sample
> ok 12 - GBWT indexes can be merged
> ok 13 - merge: 4 threads
> ok 14 - merge: 2 contigs
> ok 15 - merge: 2 haplotypes
> ok 16 - merge: 1 sample
> ok 17 - GBWT indexes can be merged with the fast algorithm
> ok 18 - fast merge: 4 threads
> ok 19 - fast merge: 2 contigs
> ok 20 - fast merge: 2 haplotypes
> ok 21 - fast merge: 1 sample
> ok 22 - the merged indexes are identical
> ok 23 - there is 1 thread in the index
> ok 24 - there are 3 threads in the index
> ok 25 - samples can be removed from a GBWT index
> ok 26 - the sample was removed
> ok 27 - threads can be extracted from GBWT
> ok 28 - the thread files are identical
> ok 29 - GBWTGraph construction was successful
> ok 30 - GBWTGraph was correctly serialized
> ok 31 - GBWT/GBWTGraph construction from path cover was successful
> ok 32 - GBWTGraph was correctly serialized
> ok 33 - path cover: 32 threads
> ok 34 - path cover: 2 contigs
> ok 35 - path cover: 16 haplotypes
> ok 36 - path cover: 16 samples
> ok 37 - GBWT/GBWTGraph construction from local haplotypes was successful
> ok 38 - GBWTGraph was correctly serialized
> ok 39 - local haplotypes: 32 threads
> ok 40 - local haplotypes: 2 contigs
> ok 41 - local haplotypes: 16 haplotypes
> ok 42 - local haplotypes: 16 samples
> ok
> t/38_vg_prune.t: line 61: hexdump: command not found
> t/38_vg_prune.t: line 63: hexdump: command not found
> t/38_vg_prune.t: line 65: hexdump: command not found
> t/38_vg_prune.t .......
> 1..18
> ok 1 - pruning produces the correct number of components
> ok 2 - pruning leaves the correct number of nodes
> ok 3 - pruning leaves the correct number of edges
> ok 4 - pruning without high-degree nodes produces the correct number of
> components
> ok 5 - pruning without high-degree nodes leaves the correct number of nodes
> ok 6 - pruning without high-degree nodes leaves the correct number of edges
> ok 7 - pruning with path restoring produces the correct number of components
> ok 8 - pruning with path restoring leaves the correct number of nodes
> ok 9 - pruning with path restoring leaves the correct number of edges
> ok 10 - pruning with path/thread unfolding produces the correct number of
> components
> ok 11 - pruning with path/thread unfolding produces the correct number of
> nodes
> ok 12 - pruning with path/thread unfolding produces the correct number of
> edges
> ok 13 - pruning with path unfolding produces the correct number of components
> ok 14 - pruning with path unfolding produces the correct number of nodes
> ok 15 - pruning with path unfolding produces the correct number of edges
> not ok 16 - unnamed test
> # got: '99_0_99_0_'
> # expected: 'empty mapping starts from the right node id'
> not ok 17 - unnamed test
> # got: '99_0_128_0_'
> # expected: 'the first unfolded graph adds the correct number of nodes to
> the mapping'
> not ok 18 - unnamed test
> # got: '99_0_156_0_'
> # expected: 'the second unfolded graph adds the correct number of nodes
> to the mapping'
> Failed 3/18 subtests
> t/39_vg_inject.t ......
> 1..10
> ok 1 - reads are generated
> ok 2 - vg inject works for all reads included in the original bam
> ok 3 - vg inject retains read names
> ok 4 - vg inject works perfectly for the position of alignment in the simple
> graph
> ok 5 - vg inject works perfectly for the position of alignment
> ok 6 - vg inject works perfectly for the mapping quality of alignment
> ok 7 - vg inject works perfectly for the cigar of alignment in the simple
> graph
> ok 8 - vg inject works perfectly for the cigar of alignment
> ok 9 - vg inject preserves all reads
> ok 10 - vg inject works perfectly for the reads flagged as is_reverse
> ok
> 1000 reads correct
> t/40_vg_gamcompare.t ..
> 1..2
> ok 1 - gamcompare completes
> ok 2 - gamcompare says the truth is correctly mapped
> ok
> t/41_vg_viz.t .........
> 1..1
> ok 1 - vg viz runs
> ok
> t/42_vg_gamsort.t .....
> 1..3
> ok 1 - Sorting a GAM orders the alignments by min node ID
> ok 2 - sorted GAMs can be indexed during the sort
> ok 3 - Sorting a GAM with RocksDB orders the alignments by min node ID
> ok
> t/43_vg_simplify.t ....
> 1..5
> ok 1 - vg simplify runs through when popping small bubbles
> ok 2 - simplification pops all the bubbles in a simple graph
> ok 3 - vg simplify runs through when removing rare variants
> ok 4 - the graph is valid after removing rare variants
> ok 5 - simplification keeps only some variants
> ok
> t/44_vg_benchmark.t ...
> 1..1
> ok 1 - vg benchmark completes succesfully
> ok
> t/45_vg_sort.t ........
> 1..6
> ok 1 - ids in our test graph are not initially in sorted order
> ok 2 - a vg graph can be sorted and indexed by ID without crashing
> ok 3 - sort by ID actually puts nodes in ID order
> ok 4 - a vg graph can be sorted topologically
> ok 5 - a vg graph can be sorted with Eades algorithm without crashing
> ok 6 - a vg graph can be sorted with the max-flow algorithm without crashing
> ok
> t/46_vg_minimizer.t ...
> 1..12
> ok 1 - default parameters
> ok 2 - single-threaded construction
> ok 3 - construction is deterministic
> ok 4 - minimizer parameters
> ok 5 - setting -k -w works correctly
> ok 6 - construction from GBWTGraph
> ok 7 - construction is deterministic
> ok 8 - construction with payload
> ok 9 - construction is deterministic
> ok 10 - multiple graphs: first
> ok 11 - multiple graphs: second
> ok 12 - construction is deterministic
> ok
> t/47_vg_dotplot.t .....
> 1..1
> ok 1 - vg dotplot runs successfully
> ok
> t/48_vg_convert.t .....
> 1..12
> ok 1 - vg convert maintains same nodes throughout xg conversion
> ok 2 - vg convert maintains same nodes throughout hash-graph conversion
> ok 3 - vg convert maintains same nodes throughout packed-graph conversion
> ok 4 - vg convert maintains same nodes throughout ODGI conversion
> ok 5 - hash graph conversion looks good
> ok 6 - packed graph conversion looks good
> ok 7 - vg conversion looks good
> ok 8 - odgi conversion looks good
> ok 9 - xg conversion looks good
> ok 10 - on disk gfa conversion looks good
> ok 11 - streaming gfa conversion looks good
> ok 12 - gfa to xg conversion looks good
> ok
> t/49_vg_depth.t .......
> 1..3
> ok 1 - vg depth gets correct depth from gam
> ok 2 - vg depth gets correct depth from pack
> ok 3 - vg depth gets correct number of bins
> ok
> index file x.fa.fai not found, generating...
> t/50_vg_gaffe.t .......
> 1..4
> ok 1 - a read can be mapped with all indexes specified without crashing
> ok 2 - a read can be mapped with just FASTA and VCF without crashing
> ok 3 - mapping with just a FASTA and a VCF produced JSON-able alignments
> ok 4 - mapping to manually-generated indexes and automatically-generated
> indexes is the same
> ok
>
> Test Summary Report
> -------------------
> t/07_vg_map.t (Wstat: 0 Tests: 54 Failed: 1)
> Failed test: 33
> t/38_vg_prune.t (Wstat: 0 Tests: 18 Failed: 3)
> Failed tests: 16-18
> Files=50, Tests=653, 186 wallclock secs ( 0.24 usr 0.05 sys + 289.05 cusr
> 49.70 csys = 339.04 CPU)
> Result: FAIL
> make[1]: *** [debian/rules:59: override_dh_auto_test-arch] Error 1
> make[1]: Leaving directory '/<<PKGBUILDDIR>>'
The full build log is available from:
http://qa-logs.debian.net/2020/06/20/vg_1.24.0+ds-1_unstable.log
A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!
About the archive rebuild: The rebuild was done on EC2 VM instances from
Amazon Web Services, using a clean, minimal and up-to-date chroot. Every
failed build was retried once to eliminate random failures.