Shruti Sridhar pushed to branch master at Debian Med / spaced
Commits: 921df8d2 by Shruti Sridhar at 2021-07-22T21:21:43+05:30 Add test data - - - - - 298e48a0 by Shruti Sridhar at 2021-07-22T21:22:14+05:30 Add autopkgtests - - - - - 9842f2b5 by Shruti Sridhar at 2021-07-22T21:22:30+05:30 Install docs - - - - - 0b545da4 by Shruti Sridhar at 2021-07-22T21:24:09+05:30 Update changelog - - - - - 9 changed files: - + debian/README.test - debian/changelog - debian/copyright - + debian/docs - + debian/examples - + debian/tests/control - + debian/tests/data/pattern - + debian/tests/data/sequence.fasta - + debian/tests/run-unit-test Changes: ===================================== debian/README.test ===================================== @@ -0,0 +1,15 @@ +Notes on how this package can be tested. +──────────────────────────────────────── + +This package can be tested by running the provided test: + + sh run-unit-test + +in order to confirm its integrity. + +Notes on the files used for testing +──────────────────────────────────────── +Files: debian/tests/data/* + +The test files (sequence.fasta and patter) was written for testing this package. + ===================================== debian/changelog ===================================== @@ -1,3 +1,12 @@ +spaced (1.2.0-201605+dfsg-3) UNRELEASED; urgency=medium + + * Team Upload. + * Add test data + * Add autopkgtests + * Install docs + + -- Shruti Sridhar <[email protected]> Thu, 22 Jul 2021 21:23:23 +0530 + spaced (1.2.0-201605+dfsg-2) unstable; urgency=medium * Team upload. ===================================== debian/copyright ===================================== @@ -11,6 +11,10 @@ Files: debian/* Copyright: © 2016 Fabian Klötzl <[email protected]> License: GPL-3+ +Files: debian/tests/data +Copyright: © 2020 Shruti Sridhar <[email protected]> +License: GPL-3+ + Files: debian/patches/0003-Add-autotools-buildsystem.patch Copyright: 2008 Benjamin Kostnik <[email protected]>, 2012 Zack Weinberg <[email protected]>, ===================================== debian/docs ===================================== @@ -0,0 +1,3 @@ +README +debian/README* +debian/tests/run-unit-test ===================================== debian/examples ===================================== @@ -0,0 +1 @@ +debian/tests/data/* \ No newline at end of file ===================================== debian/tests/control ===================================== @@ -0,0 +1,3 @@ +Tests: run-unit-test +Depends: @ +Restrictions: allow-stderr ===================================== debian/tests/data/pattern ===================================== @@ -0,0 +1 @@ +11001 \ No newline at end of file ===================================== debian/tests/data/sequence.fasta ===================================== @@ -0,0 +1,5 @@ +>AT1G00001|1|test +ATGCCGATGACTAGACTAGACATAGACATA +GGGAATAGACATAGACATAGAGCATAGACA +GATAGAGAGAACAGATAGACACACATAGACA +CACAG \ No newline at end of file ===================================== debian/tests/run-unit-test ===================================== @@ -0,0 +1,17 @@ +#!/bin/bash +set -e + +pkg=spaced + +export LC_ALL=C.UTF-8 +if [ "${AUTOPKGTEST_TMP}" = "" ] ; then + AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) + trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM +fi + +cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}" + +cd "${AUTOPKGTEST_TMP}" + +spaced -o output -f pattern sequence.fasta +[ -s "output" ] && echo "Pass Test" View it on GitLab: https://salsa.debian.org/med-team/spaced/-/compare/f3a625f1c0a8ec440a3948dd9324e7dde4ac3ec2...0b545da4584465e42958e6b7d8278fad4a7b3e38 -- View it on GitLab: https://salsa.debian.org/med-team/spaced/-/compare/f3a625f1c0a8ec440a3948dd9324e7dde4ac3ec2...0b545da4584465e42958e6b7d8278fad4a7b3e38 You're receiving this email because of your account on salsa.debian.org.
_______________________________________________ debian-med-commit mailing list [email protected] https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
