Shruti Sridhar pushed to branch master at Debian Med / blasr
Commits: ba610e32 by Shruti Sridhar at 2021-07-31T23:19:28+05:30 Add test data - - - - - 0d6a57ef by Shruti Sridhar at 2021-07-31T23:19:48+05:30 Add autopkgtest - - - - - 65276bd0 by Shruti Sridhar at 2021-07-31T23:20:04+05:30 Install docs - - - - - 8 changed files: - + debian/README.test - debian/copyright - debian/docs - + debian/examples - + debian/tests/control - + debian/tests/data/query.fasta - + debian/tests/data/ref.fa - + debian/tests/run-unit-test Changes: ===================================== debian/README.test ===================================== @@ -0,0 +1,14 @@ +Notes on how this package can be tested. +──────────────────────────────────────── + +This package can be tested by running the provided test: + + sh run-unit-test + +in order to confirm its integrity. + +Notes on the files used for testing +──────────────────────────────────────── +Files: debian/tests/data/* + +The test files query.fasta and ref.fa were written for testing this package. \ No newline at end of file ===================================== debian/copyright ===================================== @@ -14,6 +14,9 @@ Files: debian/* Copyright: 2015-2016 Afif Elghraoui <[email protected]> License: PacBio-BSD-3-Clause +Files: debian/tests/data +Copyright: Shruti Sridhar <[email protected]> + License: PacBio-BSD-3-Clause Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions ===================================== debian/docs ===================================== @@ -1 +1,3 @@ -README* +README.md +debian/README* +debian/tests/run-unit-test ===================================== debian/examples ===================================== @@ -0,0 +1 @@ +debian/tests/data/* \ No newline at end of file ===================================== debian/tests/control ===================================== @@ -0,0 +1,3 @@ +Tests: run-unit-test +Depends: @ +Restrictions: allow-stderr ===================================== debian/tests/data/query.fasta ===================================== @@ -0,0 +1,2 @@ +>movie/0/0_64 +ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAG \ No newline at end of file ===================================== debian/tests/data/ref.fa ===================================== @@ -0,0 +1,2 @@ +>test/0/0_68 +ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAGATGCTAGC \ No newline at end of file ===================================== debian/tests/run-unit-test ===================================== @@ -0,0 +1,28 @@ +#!/bin/bash +set -e + +pkg=blasr + +export LC_ALL=C.UTF-8 +if [ "${AUTOPKGTEST_TMP}" = "" ] ; then + AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) + trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM +fi + +cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}" + +cd "${AUTOPKGTEST_TMP}" + +blasr query.fasta ref.fa --sam --out alignment.sam +blasr query.fasta ref.fa --minMatch 1 --maxMatch 10 > output +if [ $(dpkg-architecture -qDEB_BUILD_ARCH) = "amd64" ] +then + echo "8db2f4d5737a90d087da90a6779c8d7b output" >> checksums + echo "0a61b96282acbc63df897dd1510ea0ad alignment.sam" >> checksums + + md5sum --check checksums + echo "Expected output and generated output are same: PASS Test" +else + [ -s "output" ] && [ -s "alignment.sam" ] || exit 1 + echo "PASS Test" +fi \ No newline at end of file View it on GitLab: https://salsa.debian.org/med-team/blasr/-/compare/81f260d916c71b9d655dd3781a3b527d5cca0fa0...65276bd00ee42fda9bfae89d5416db5455ff224f -- View it on GitLab: https://salsa.debian.org/med-team/blasr/-/compare/81f260d916c71b9d655dd3781a3b527d5cca0fa0...65276bd00ee42fda9bfae89d5416db5455ff224f You're receiving this email because of your account on salsa.debian.org.
_______________________________________________ debian-med-commit mailing list [email protected] https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
