Shruti Sridhar pushed to branch master at Debian Med / perm
Commits: a961c0a0 by Shruti Sridhar at 2021-08-01T19:30:13+05:30 Add testdata - - - - - 2b0098c9 by Shruti Sridhar at 2021-08-01T19:30:30+05:30 Add autopkgtest - - - - - 0509f410 by Shruti Sridhar at 2021-08-01T19:30:44+05:30 Install docs - - - - - 1746f4b6 by Shruti Sridhar at 2021-08-01T19:32:52+05:30 Update changelog - - - - - 9 changed files: - + debian/README.test - debian/changelog - debian/copyright - + debian/docs - + debian/examples - + debian/tests/control - + debian/tests/data/Reads.fasta - + debian/tests/data/Ref.fasta - + debian/tests/run-unit-test Changes: ===================================== debian/README.test ===================================== @@ -0,0 +1,14 @@ +Notes on how this package can be tested. +──────────────────────────────────────── + +This package can be tested by running the provided test: + + sh run-unit-test + +in order to confirm its integrity. + +Notes on the files used for testing +──────────────────────────────────────── +Files: debian/tests/data/* + +The Ref.fasta and Reads.fasta file were written for testing this package. \ No newline at end of file ===================================== debian/changelog ===================================== @@ -1,3 +1,12 @@ +perm (0.4.0-6) UNRELEASED; urgency=medium + + * Team Upload. + * Add testdata + * Add autopkgtest + * Install docs + + -- Shruti Sridhar <[email protected]> Sun, 01 Aug 2021 19:32:02 +0530 + perm (0.4.0-5) unstable; urgency=medium * Standards-Version: 4.5.1 (routine-update) ===================================== debian/copyright ===================================== @@ -12,6 +12,10 @@ Copyright: (c) 2012-2014 Hyun Soon Gweon <[email protected]> 2014-2017 Andreas Tille <[email protected]> License: Apache-2.0 +Files: debian/tests/data +Copyright: Shruti Sridhar <[email protected]> +License: Apache-2.0 + License: Apache-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, ===================================== debian/docs ===================================== @@ -0,0 +1,2 @@ +debian/README* +debian/tests/run-unit-test \ No newline at end of file ===================================== debian/examples ===================================== @@ -0,0 +1 @@ +debian/tests/data/* \ No newline at end of file ===================================== debian/tests/control ===================================== @@ -0,0 +1,3 @@ +Tests: run-unit-test +Depends: @ +Restrictions: allow-stderr ===================================== debian/tests/data/Reads.fasta ===================================== @@ -0,0 +1,2 @@ +>reads +ATGCGCATCGACATGACATACGACATCA \ No newline at end of file ===================================== debian/tests/data/Ref.fasta ===================================== @@ -0,0 +1,2 @@ +>ref +ATGCTAGCATACGACTACAGCATACAGCATCAGACTACGACATCAGACTACAGCATACAGCAATACGACTACAGCATACGACTACAGCATCAGATGCTACGCAGACTACGACATCAGACTACAGCATACGACATCAGACTACTACAGACACAGACACGACGACGACGACTACGACACGACGACTACATCAGACGACGACAGCAGCAGCGACAGCAGACGACATACGACAGCATACGACGACAGACATCAGACGACGACGACGACGACGACGACGACCAGACGCATCAGCAGACACGACGAAAAAAAGGAGCATCAGCA \ No newline at end of file ===================================== debian/tests/run-unit-test ===================================== @@ -0,0 +1,17 @@ +#!/bin/bash +set -e + +pkg=perm + +export LC_ALL=C.UTF-8 +if [ "${AUTOPKGTEST_TMP}" = "" ] ; then + AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) + trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM +fi + +cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}" + +cd "${AUTOPKGTEST_TMP}" + +perm Ref.fasta Reads.fasta -v 100 -A -o out.sam +[ -s "out.sam" ] || exit 1 && echo "PASS test" \ No newline at end of file View it on GitLab: https://salsa.debian.org/med-team/perm/-/compare/fcab8a503500cd6ac7cf18060ce20ced6fc5c314...1746f4b67efdc264aae4df95520a9266600fcc5e -- View it on GitLab: https://salsa.debian.org/med-team/perm/-/compare/fcab8a503500cd6ac7cf18060ce20ced6fc5c314...1746f4b67efdc264aae4df95520a9266600fcc5e You're receiving this email because of your account on salsa.debian.org.
_______________________________________________ debian-med-commit mailing list [email protected] https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
