Author: alteholz Date: 2013-09-17 17:32:22 +0000 (Tue, 17 Sep 2013) New Revision: 14730
Added: trunk/packages/mira/trunk/debian/patches/make.patch trunk/packages/mira/trunk/debian/patches/spelling.patch Modified: trunk/packages/mira/trunk/debian/changelog trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides trunk/packages/mira/trunk/debian/patches/series Log: progress for rc1 Modified: trunk/packages/mira/trunk/debian/changelog =================================================================== --- trunk/packages/mira/trunk/debian/changelog 2013-09-17 15:20:29 UTC (rev 14729) +++ trunk/packages/mira/trunk/debian/changelog 2013-09-17 17:32:22 UTC (rev 14730) @@ -1,3 +1,10 @@ +mira (4.0~rc1-1) UNRELEASED; urgency=low + + * TODO wait for rc2 and boost transition! + * New upstream version + + -- Thorsten Alteholz <[email protected]> Tue, 17 Sep 2013 18:00:00 +0200 + mira (3.9.18-1) unstable; urgency=low * New upstream version (most patches applied by upstream) Modified: trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides =================================================================== --- trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides 2013-09-17 15:20:29 UTC (rev 14729) +++ trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides 2013-09-17 17:32:22 UTC (rev 14730) @@ -1,4 +1,2 @@ # according to www.dict.cc transfering is American English spelling mira-assembler: spelling-error-in-binary usr/bin/mira Transfering Transferring -mira-assembler: spelling-error-in-binary usr/bin/convert_project Transfering Transferring - Added: trunk/packages/mira/trunk/debian/patches/make.patch =================================================================== --- trunk/packages/mira/trunk/debian/patches/make.patch (rev 0) +++ trunk/packages/mira/trunk/debian/patches/make.patch 2013-09-17 17:32:22 UTC (rev 14730) @@ -0,0 +1,26 @@ +Index: mira-4.0rc1/src/progs/Makefile.am +=================================================================== +--- mira-4.0rc1.orig/src/progs/Makefile.am 2013-08-17 16:11:50.000000000 +0200 ++++ mira-4.0rc1/src/progs/Makefile.am 2013-09-17 14:41:44.000000000 +0200 +@@ -49,7 +49,7 @@ + rm -f miramem$(EXEEXT) && \ + $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \ + rm -f mirabait$(EXEEXT) && \ +- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\ ++ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \ + rm -f miraconvert$(EXEEXT) && \ + $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT) + +Index: mira-4.0rc1/src/progs/Makefile.in +=================================================================== +--- mira-4.0rc1.orig/src/progs/Makefile.in 2013-08-17 16:13:05.000000000 +0200 ++++ mira-4.0rc1/src/progs/Makefile.in 2013-09-17 15:06:06.000000000 +0200 +@@ -609,7 +609,7 @@ + rm -f miramem$(EXEEXT) && \ + $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \ + rm -f mirabait$(EXEEXT) && \ +- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\ ++ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \ + rm -f miraconvert$(EXEEXT) && \ + $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT) + Modified: trunk/packages/mira/trunk/debian/patches/series =================================================================== --- trunk/packages/mira/trunk/debian/patches/series 2013-09-17 15:20:29 UTC (rev 14729) +++ trunk/packages/mira/trunk/debian/patches/series 2013-09-17 17:32:22 UTC (rev 14730) @@ -1 +1,3 @@ -boost-minimal.patch +#boost-minimal.patch +make.patch +spelling.patch Added: trunk/packages/mira/trunk/debian/patches/spelling.patch =================================================================== --- trunk/packages/mira/trunk/debian/patches/spelling.patch (rev 0) +++ trunk/packages/mira/trunk/debian/patches/spelling.patch 2013-09-17 17:32:22 UTC (rev 14730) @@ -0,0 +1,26 @@ +Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd +=================================================================== +--- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd 2013-08-17 16:11:50.000000000 +0200 ++++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd 2013-09-17 15:43:44.000000000 +0200 +@@ -37,7 +37,7 @@ + Fcon conflict sequence_conflict SO:0001085 independent determinations of the "same" sequence differ at this site or region; Or /compare=[accession-number.sequence-version] Different sources report differing sequences. [EBIBS:GAR, UniProt:curation_manual] + Fenh enhancer enhancer SO:0000165 a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter; A cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter. + Fexn exon exon SO:0000147 region of genome that codes for portion of spliced mRNA, rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR; A region of the genome that codes for portion of spliced messenger RNA (SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading frames (SO:0000236) and 3'-untranslated region (SO:0000205). +-Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unkown bases are filled in with N's. ++Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unknown bases are filled in with N's. + Fgen gene gene SO:0000704 region of biological interest identified as a gene and for which a name has been assigned; A locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions + FiDN iDNA iDNA SO:0000723 intervening DNA; DNA which is eliminated through any of several kinds of recombination; Genomic sequence removed from the genome, as a normal event, by a process of recombination. + Fint intron intron SO:0000188 a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it; A segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it. +Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd +=================================================================== +--- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd 2013-08-17 16:11:50.000000000 +0200 ++++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd 2013-09-17 15:44:15.000000000 +0200 +@@ -9,7 +9,7 @@ + # sequences must be included extra in this file (see "rev_*" + # down below + # +->unkown_lookslike_adaptorB ++>unknown_lookslike_adaptorB + ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA + >unknown_from_cDNA_project_titanium450bp + TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG _______________________________________________ debian-med-commit mailing list [email protected] http://lists.alioth.debian.org/cgi-bin/mailman/listinfo/debian-med-commit
