Author: alteholz
Date: 2013-09-17 17:32:22 +0000 (Tue, 17 Sep 2013)
New Revision: 14730

Added:
   trunk/packages/mira/trunk/debian/patches/make.patch
   trunk/packages/mira/trunk/debian/patches/spelling.patch
Modified:
   trunk/packages/mira/trunk/debian/changelog
   trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides
   trunk/packages/mira/trunk/debian/patches/series
Log:
progress for rc1

Modified: trunk/packages/mira/trunk/debian/changelog
===================================================================
--- trunk/packages/mira/trunk/debian/changelog  2013-09-17 15:20:29 UTC (rev 
14729)
+++ trunk/packages/mira/trunk/debian/changelog  2013-09-17 17:32:22 UTC (rev 
14730)
@@ -1,3 +1,10 @@
+mira (4.0~rc1-1) UNRELEASED; urgency=low
+
+  * TODO wait for rc2 and boost transition!
+  * New upstream version 
+
+ -- Thorsten Alteholz <[email protected]>  Tue, 17 Sep 2013 18:00:00 +0200
+
 mira (3.9.18-1) unstable; urgency=low
 
   * New upstream version (most patches applied by upstream)

Modified: trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides
===================================================================
--- trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides   
2013-09-17 15:20:29 UTC (rev 14729)
+++ trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides   
2013-09-17 17:32:22 UTC (rev 14730)
@@ -1,4 +1,2 @@
 # according to www.dict.cc transfering is American English spelling
 mira-assembler: spelling-error-in-binary usr/bin/mira Transfering Transferring
-mira-assembler: spelling-error-in-binary usr/bin/convert_project Transfering 
Transferring
-

Added: trunk/packages/mira/trunk/debian/patches/make.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/make.patch                         
(rev 0)
+++ trunk/packages/mira/trunk/debian/patches/make.patch 2013-09-17 17:32:22 UTC 
(rev 14730)
@@ -0,0 +1,26 @@
+Index: mira-4.0rc1/src/progs/Makefile.am
+===================================================================
+--- mira-4.0rc1.orig/src/progs/Makefile.am     2013-08-17 16:11:50.000000000 
+0200
++++ mira-4.0rc1/src/progs/Makefile.am  2013-09-17 14:41:44.000000000 +0200
+@@ -49,7 +49,7 @@
+       rm -f miramem$(EXEEXT) && \
+       $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
+       rm -f mirabait$(EXEEXT) && \
+-      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
++      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
+       rm -f miraconvert$(EXEEXT) && \
+       $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
+ 
+Index: mira-4.0rc1/src/progs/Makefile.in
+===================================================================
+--- mira-4.0rc1.orig/src/progs/Makefile.in     2013-08-17 16:13:05.000000000 
+0200
++++ mira-4.0rc1/src/progs/Makefile.in  2013-09-17 15:06:06.000000000 +0200
+@@ -609,7 +609,7 @@
+       rm -f miramem$(EXEEXT) && \
+       $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
+       rm -f mirabait$(EXEEXT) && \
+-      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
++      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
+       rm -f miraconvert$(EXEEXT) && \
+       $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
+ 

Modified: trunk/packages/mira/trunk/debian/patches/series
===================================================================
--- trunk/packages/mira/trunk/debian/patches/series     2013-09-17 15:20:29 UTC 
(rev 14729)
+++ trunk/packages/mira/trunk/debian/patches/series     2013-09-17 17:32:22 UTC 
(rev 14730)
@@ -1 +1,3 @@
-boost-minimal.patch
+#boost-minimal.patch
+make.patch
+spelling.patch

Added: trunk/packages/mira/trunk/debian/patches/spelling.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/spelling.patch                     
        (rev 0)
+++ trunk/packages/mira/trunk/debian/patches/spelling.patch     2013-09-17 
17:32:22 UTC (rev 14730)
@@ -0,0 +1,26 @@
+Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd
+===================================================================
+--- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd 2013-08-17 16:11:50.000000000 
+0200
++++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd      2013-09-17 15:43:44.000000000 
+0200
+@@ -37,7 +37,7 @@
+ Fcon  conflict        sequence_conflict       SO:0001085      independent 
determinations of the "same" sequence differ at this site or region; Or 
/compare=[accession-number.sequence-version]        Different sources report 
differing sequences. [EBIBS:GAR, UniProt:curation_manual]
+ Fenh  enhancer        enhancer        SO:0000165      a cis-acting sequence 
that increases the utilization of (some)  eukaryotic promoters, and can 
function in either orientation and in any location (upstream or downstream) 
relative to the promoter;     A cis-acting sequence that increases the 
utilization of (some) eukaryotic promoters, and can function in either 
orientation and in any location (upstream or downstream) relative to the 
promoter.
+ Fexn  exon    exon    SO:0000147      region of genome that codes for portion 
of spliced mRNA,  rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR;        
A region of the genome that codes for portion of spliced messenger RNA 
(SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading 
frames (SO:0000236) and 3'-untranslated region (SO:0000205).
+-Fgap  gap     gap     SO:0000730      gap in the sequence     A gap in the 
sequence of known length. THe unkown bases are filled in with N's.
++Fgap  gap     gap     SO:0000730      gap in the sequence     A gap in the 
sequence of known length. THe unknown bases are filled in with N's.
+ Fgen  gene    gene    SO:0000704      region of biological interest 
identified as a gene  and for which a name has been assigned;     A locatable 
region of genomic sequence, corresponding to a unit of inheritance, which is 
associated with regulatory regions, transcribed regions and/or other functional 
sequence regions
+ FiDN  iDNA    iDNA    SO:0000723      intervening DNA; DNA which is 
eliminated through any of several kinds of recombination; Genomic sequence 
removed from the genome, as a normal event, by a process of recombination. 
+ Fint  intron  intron  SO:0000188      a segment of DNA that is transcribed, 
but removed from within the transcript by splicing together the sequences 
(exons) on either side of it;   A segment of DNA that is transcribed, but 
removed from within the transcript by splicing together the sequences (exons) 
on either side of it.
+Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd
+===================================================================
+--- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd  2013-08-17 
16:11:50.000000000 +0200
++++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd       2013-09-17 
15:44:15.000000000 +0200
+@@ -9,7 +9,7 @@
+ # sequences must be included extra in this file (see "rev_*"
+ # down below
+ #
+->unkown_lookslike_adaptorB
++>unknown_lookslike_adaptorB
+ ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA
+ >unknown_from_cDNA_project_titanium450bp
+ TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG


_______________________________________________
debian-med-commit mailing list
[email protected]
http://lists.alioth.debian.org/cgi-bin/mailman/listinfo/debian-med-commit

Reply via email to