This is an automated email from the git hooks/post-receive script.

afif-guest pushed a commit to branch master
in repository python-pbconsensuscore.

commit efb807b65485cab5caaeacf6d24e73373ec72c46
Author: Afif Elghraoui <[email protected]>
Date:   Tue Nov 24 22:44:13 2015 -0800

    Imported Upstream version 1.0.1
---
 CHANGELOG.md                       |  4 ++++
 include/ConsensusCore/Version.hpp  |  2 +-
 setup.py                           |  2 +-
 src/C++/Poa/PoaGraphImpl.cpp       |  2 +-
 src/C++/Poa/PoaGraphImpl.hpp       | 35 +++++++++++++++++++++++++++++++
 src/C++/Poa/PoaGraphTraversals.cpp |  2 +-
 src/C++/Poa/RangeFinder.cpp        |  2 +-
 src/C++/Quiver/MutationScorer.cpp  | 27 ++++++++++++++++--------
 src/Tests/TestPoaConsensus.cpp     | 42 ++++++++++++++++++++++++++++++++++++++
 9 files changed, 104 insertions(+), 14 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 85afbe5..d959193 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -1,3 +1,7 @@
+* Version 1.0.1
+  - Fix for a serious memory leak occurring on alpha/beta mating failures.  
Thanks Nigel!
+  - Fix for nondeterministic POA consensus
+
 * Version 1.0.0
   - Minor build/deploy system tweaks.  No API changes.
 
diff --git a/include/ConsensusCore/Version.hpp 
b/include/ConsensusCore/Version.hpp
index 316d02c..2c116ed 100644
--- a/include/ConsensusCore/Version.hpp
+++ b/include/ConsensusCore/Version.hpp
@@ -43,7 +43,7 @@
 
 #define API_MAJOR 1
 #define API_MINOR 0
-#define API_PATCH 0
+#define API_PATCH 1
 
 namespace ConsensusCore
 {
diff --git a/setup.py b/setup.py
index ccaaeb9..9f91a40 100755
--- a/setup.py
+++ b/setup.py
@@ -94,7 +94,7 @@ if "install" in sys.argv and not "build" in sys.argv:
     sys.argv.insert(installPos, "build")
 
 setup(name="ConsensusCore",
-      version="1.0.0",
+      version="1.0.1",
       author="Pacific Biosciences",
       author_email="[email protected]",
       url="http://www.github.com/PacificBiosciences/ConsensusCore";,
diff --git a/src/C++/Poa/PoaGraphImpl.cpp b/src/C++/Poa/PoaGraphImpl.cpp
index 188fd79..266b0b4 100644
--- a/src/C++/Poa/PoaGraphImpl.cpp
+++ b/src/C++/Poa/PoaGraphImpl.cpp
@@ -155,7 +155,7 @@ namespace detail {
     {
         vector<const AlignmentColumn*> predecessorColumns;
         const AlignmentColumn* predCol;
-        foreach (ED e, in_edges(v, g))
+        foreach (ED e, inEdges(v, g))
         {
             VD u = source(e, g);
             predCol = colMap.at(u);
diff --git a/src/C++/Poa/PoaGraphImpl.hpp b/src/C++/Poa/PoaGraphImpl.hpp
index 9aed30c..afa0a20 100644
--- a/src/C++/Poa/PoaGraphImpl.hpp
+++ b/src/C++/Poa/PoaGraphImpl.hpp
@@ -107,6 +107,41 @@ namespace detail {
     typedef property_map<BoostGraph, vertex_index_t>::type index_map_t;
     static const VD null_vertex = graph_traits<BoostGraph>::null_vertex();
 
+
+    struct EdgeComparator
+    {
+        EdgeComparator(const BoostGraph& g) : g_(g) {}
+
+        // want lex. comparison... just using pair to get it..
+        bool operator() (ED e1, ED e2)
+        {
+            std::pair<int, int> vt1, vt2;
+            vt1 = std::make_pair(get(vertex_index, g_, source(e1, g_)),
+                                 get(vertex_index, g_, target(e1, g_)));
+            vt2 = std::make_pair(get(vertex_index, g_, source(e2, g_)),
+                                 get(vertex_index, g_, target(e2, g_)));
+            return (vt1 < vt2);
+        }
+
+    private:
+        const BoostGraph& g_;
+    };
+
+    inline std::vector<ED> inEdges(VD v, const BoostGraph& g)
+    {
+        // This is a sad workaround the nondeterministic order of iteration
+        // from BGL's in_edges. (see: 
http://stackoverflow.com/questions/30968690/)
+
+        // Unfortunately, we can't just use the boost::sort range adapter
+        // because it requires an underlying random access iterator, which
+        // we can't get from the std::set container.
+        graph_traits<BoostGraph>::in_edge_iterator begin, end;
+        tie(begin, end) = in_edges(v, g);
+        std::vector<ED> tmp(begin, end);
+        std::sort(tmp.begin(), tmp.end(), EdgeComparator(g));
+        return tmp;
+       }
+
     struct AlignmentColumn : noncopyable
     {
         VD CurrentVertex;
diff --git a/src/C++/Poa/PoaGraphTraversals.cpp 
b/src/C++/Poa/PoaGraphTraversals.cpp
index e5862ce..dfce3f6 100644
--- a/src/C++/Poa/PoaGraphTraversals.cpp
+++ b/src/C++/Poa/PoaGraphTraversals.cpp
@@ -124,7 +124,7 @@ namespace detail {
             vInfo.Score = score;
             vInfo.ReachingScore = score;
             bestPrevVertex[v] = null_vertex;
-            foreach (ED e, in_edges(v, g_))
+            foreach (ED e, inEdges(v, g_))
             {
                 VD sourceVertex = source(e, g_);
                 float rsc = score + vertexInfoMap_[sourceVertex].ReachingScore;
diff --git a/src/C++/Poa/RangeFinder.cpp b/src/C++/Poa/RangeFinder.cpp
index c4f4d1b..1c300f4 100644
--- a/src/C++/Poa/RangeFinder.cpp
+++ b/src/C++/Poa/RangeFinder.cpp
@@ -123,7 +123,7 @@ namespace detail {
                 fwdMarks[v] = directRange.get();
             } else {
                 std::vector<Interval> predRangesStepped;
-                foreach (ED e, in_edges(v, poaGraph.g_))
+                foreach (ED e, inEdges(v, poaGraph.g_))
                 {
                     VD pred = source(e, poaGraph.g_);
                     Interval predRangeStepped = next(fwdMarks.at(pred), 
readLength);
diff --git a/src/C++/Quiver/MutationScorer.cpp 
b/src/C++/Quiver/MutationScorer.cpp
index 5a0606d..1f42fea 100644
--- a/src/C++/Quiver/MutationScorer.cpp
+++ b/src/C++/Quiver/MutationScorer.cpp
@@ -57,15 +57,24 @@ namespace ConsensusCore
         : evaluator_(new EvaluatorType(evaluator)),
           recursor_(new R(recursor))
     {
-        // Allocate alpha and beta
-        alpha_ = new MatrixType(evaluator.ReadLength() + 1,
-                                evaluator.TemplateLength() + 1);
-        beta_ = new MatrixType(evaluator.ReadLength() + 1,
-                               evaluator.TemplateLength() + 1);
-        // Buffer where we extend into
-        extendBuffer_ = new MatrixType(evaluator.ReadLength() + 1, 
EXTEND_BUFFER_COLUMNS);
-        // Initial alpha and beta
-        numFlipFlops_ = recursor.FillAlphaBeta(*evaluator_, *alpha_, *beta_);
+        try {
+            // Allocate alpha and beta
+            alpha_ = new MatrixType(evaluator.ReadLength() + 1,
+                                    evaluator.TemplateLength() + 1);
+            beta_ = new MatrixType(evaluator.ReadLength() + 1,
+                                   evaluator.TemplateLength() + 1);
+            // Buffer where we extend into
+            extendBuffer_ = new MatrixType(evaluator.ReadLength() + 1, 
EXTEND_BUFFER_COLUMNS);
+            // Initial alpha and beta
+            numFlipFlops_ = recursor.FillAlphaBeta(*evaluator_, *alpha_, 
*beta_);
+        }
+        catch(AlphaBetaMismatchException e) {
+            delete alpha_;
+            delete beta_;
+            delete extendBuffer_;
+            delete recursor_;
+            throw;
+        }
     }
 
     template<typename R>
diff --git a/src/Tests/TestPoaConsensus.cpp b/src/Tests/TestPoaConsensus.cpp
index 7717c33..5ef7796 100644
--- a/src/Tests/TestPoaConsensus.cpp
+++ b/src/Tests/TestPoaConsensus.cpp
@@ -530,3 +530,45 @@ TEST(PoaConsensus, TestMutations)
     delete pc;
 }
 #endif
+
+
+TEST(PoaConsensus, NondeterminismRegressionTest)
+{
+    //
+    // This is a regression test for a real-world case of
+    // nondeterminism found in the POA on a quiver job on Staph.
+    //
+    std::vector<std::string> reads;
+    reads += \
+        
"TATCAATCAACGAAATTCGCCAATTCCGTCATGAATGTCAATATCTAACTACACTTTAGAATACATTCTT"
+        
"TGACATGCCTGGCCTATTGATATTTCAATAAAATCAGACTATAAAGACAACTTACAAATGATCCTATAAA"
+        
"TTAAAGATCGAGAATCTAAAGAGTGAAATTAAAGCTAATTACTGCTTTAAAAATTTTACGTGCACACAAA"
+        
"AATGAATTTATCCTCATTATATCGAAAATACCATGAAGTATAGTAAGCTAACTTGAATATGATCATTAAT"
+        
"CGGCTATATGATTATTTTGATAATGCAATGAGCATCAATCTGAATTTATGACCTATCATTCGCGTTGCAT"
+        
"TTATTGAAGTGAAAATTCATGTACGCTTTTTTATTTTATTAATATAATCCTTGATATTGGTTATATACCA"
+        "CGCTGTCACATAATTTTCAATAAATTTTTCTACTAAATGAAGTGTCTGTTATCTATCAC";
+    reads += \
+        
"TATCAACAACGAAAATGCGCAGTTACGTCATGATTTATGTCAAATAATCTAAACGACACTTTCAGAAATA"
+        
"AATACATTCGAGAAGATGAATGCCTGGCGCAAAGTGATTATTTCAATAAAATATTTGTACCTTGAAAGAC"
+        
"AATTTACAAATGAATGCTATAAAATTTAAATGGATCCGGAGAATCTTTAAAGTACGTGAAATTAAAGGCT"
+        
"AAGATTACTGCGAAAAATTTTCGTGCACAAGAAATGAATGTTCCAGATTAGTATCGGAAAATAAGCCATG"
+        
"AAGAAGCTAGCATTAACTTGAATATGATCGATTTAATCGGCAGTATTGGTAATTATCTTGATAAGCAATT"
+        
"GAGCATCAACTGAAATTGAATGACTCTACATGCCTCGCTGAGTATGCGATTTATTGAAAGTGAAATTCAG"
+        
"TAAAGTTTATTGTTATGAATAAATGCGTACTTGGATGAATATCCCGACGGTAGTTCAAGTGTAAATGGAG"
+        
"TGAGGGGGTTCTTTCTTATAGAATAGTTTTATACTACTGATAAGGTGTAACCTGAGTGAGTCGTGATTTT"
+        "AGAGTTACTTGCGAAC";
+
+    std::set<std::string> answers;
+    for (int run=0; run<1000; run++)
+    {
+        const PoaConsensus* pc = PoaConsensus::FindConsensus(reads, GLOBAL);
+#if 0
+        char fname[100];
+        sprintf(fname, "/tmp/gr%03d.dot", run);
+        pc->WriteGraphVizFile(fname, (PoaGraph::VERBOSE_NODES | 
PoaGraph::COLOR_NODES));
+#endif
+        answers.insert(pc->Sequence);
+        delete pc;
+    }
+    ASSERT_EQ(1, answers.size());
+}

-- 
Alioth's /usr/local/bin/git-commit-notice on 
/srv/git.debian.org/git/debian-med/python-pbconsensuscore.git

_______________________________________________
debian-med-commit mailing list
[email protected]
http://lists.alioth.debian.org/cgi-bin/mailman/listinfo/debian-med-commit

Reply via email to