Hi Charles, you should try the new indexing program dbxflat. I have miRNA.dat indexed with this and retrieval with ID and ACC work fine on my system (EMBOSS 4.1.0).
HTH, David. [EMAIL PROTECTED] schrieb am 29/05/2007 10:37:10: > Dear list, > > I have tried to index mirbase, the miRNA database, with dbiflat, but in that > case I can only retrieve the seqences by their accession numbers, and not by > their IDs: > > gslc12『mirbase3』$ seqret mirbase:MI0004658 stdout > Reads and writes (returns) sequences > >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop > uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag > cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua > > gslc12『mirbase3』$ seqret mirbase:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12『mirbase3』$ seqret mirbase-ID:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-ID:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12『mirbase3』$ seqret mirbase-id:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-id:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > Here is the command line I used: > > dbiflat -dbname mirbase\ > -idformat EMBL\ > -directory .\ > -filenames miRNA.dat\ > -release 9.1\ > -date `date +%d/%m/%y`\ > -outfile /dev/stdout > > And here is the embossrc I use: > > DB mirbase [ > type: N > format: embl > method: emblcd > directory: /usr/share/mirbase/emboss > file: *.dat > ] > > Is it a bug, or did I miss something ? > > Have a nice day, > > -- > Charles Plessy > http://charles.plessy.org > Wako, Saitama, Japan > _______________________________________________ > EMBOSS mailing list > [email protected] > http://lists.open-bio.org/mailman/listinfo/emboss _______________________________________________ EMBOSS mailing list [email protected] http://lists.open-bio.org/mailman/listinfo/emboss
