Hi Karin, you can pipe the output from extractfeat into transeq to get the protein sequence:
extractfeat mysequence.gb -type CDS -stdout | transeq -filter HTH, David. [email protected] schrieb am 24/08/2010 19:43:49: > Extractfeat gives me sensible description lines, but for now I have not > been able to make it give me the protein, and not the DNA sequence. > > >scaffold00002_93_1919 [CDS] Contig scaffold00002 > atgaccctagaaaatacctctcccaatcctagtcaaatttccctaaatttgtcgggagga > attgccctcggagcttatatggctggggtgtgttttgaattagttagacaagccagaaaa > gacaattctcccctgttaattgatttgattaccggagcatctgctggggcgatgaccgga > .... > > > So. Are there any other programs, or options/switches to the ones that I > have mentioned that I should be using? > > > TIA, > > Karin > > -- > Karin Lagesen > Post Doc > Centre of Ecological and Evolutionary Synthesis (CEES) > Department of Biology > University of Oslo > P.O. Box 1066 - Blindern > N-0316 Oslo > Norway > _______________________________________________ > EMBOSS mailing list > [email protected] > http://lists.open-bio.org/mailman/listinfo/emboss _______________________________________________ EMBOSS mailing list [email protected] http://lists.open-bio.org/mailman/listinfo/emboss
