On Jan 9, 2012, at 12:58 AM, david.ba...@bayer.com wrote:
Hi Mike,
if you send a plain sequence via stdin to an EMBOSS program, you
must explicitly specify the sequence format as "plain".
echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain
David.
Thanks, David. That was the problem.
Mike
emboss-boun...@lists.open-bio.org schrieb am 08/01/2012 17:57:35:
> Greetings
>
> It seems like this should work:
>
> $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter
> Error: Unable to read sequence 'stdin'
> Died: palindrome terminated: Bad value for '-sequence' with -auto
> defined
>
> and yet as you can see, it does not. I haven't used it for awhile,
but
> I recall it used to work.
>
> I've searched the docs and tried all the permutations on the
command I
> can think of and I'm getting nowhere.
>
> Does anyone see a problem with the command or have a suggestion
where
> to search for a problem?
>
> Thanks
>
> Mike
>
> Michael Muratet, Ph.D.
> Senior Scientist
> HudsonAlpha Institute for Biotechnology
> mmura...@hudsonalpha.org
> (256) 327-0473 (p)
> (256) 327-0966 (f)
>
> Room 4005
> 601 Genome Way
> Huntsville, Alabama 35806
>
>
>
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS@lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
Michael Muratet, Ph.D.
Senior Scientist
HudsonAlpha Institute for Biotechnology
mmura...@hudsonalpha.org
(256) 327-0473 (p)
(256) 327-0966 (f)
Room 4005
601 Genome Way
Huntsville, Alabama 35806
_______________________________________________
EMBOSS mailing list
EMBOSS@lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss
