I found a website that uses (I believe) a perl script to get to a program called codonw. This is an app that will analyze a DNA sequence and provide information about its codon makeup. I find that konqueror doesn't do this page/web interface properly but netscape does. The site is: http://bioweb.pasteur.fr/seqanal/interfaces/codonw.html Simply enter you email address at the top and then copy/paste this sequence into the window #2 under "sequences" as a test: cctcagatcactctttggcagcgacccctcgtcacaataaagataggggggcaattaaag gaagctctattagatacaggagcagatgatacagtattagaagaaatgaatttgccagga agatggaaaccaaaaatgatagggggaattggaggttttatcaaagtaagacagtatgat cagatactcatagaaatctgcggacataaagctataggtacagtattagtaggacctaca cctgtcaacataattggaagaaatctgttgactcagattggctgcactttaaattttccc attagtcctattgagactgtaccagtaaaattaaagccaggagtggatggcccaaaagtt aaacaatggccattgacagaagaaaaaataaaagcattagtagaaatttgtacagaaatg gaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtattt And select the "Run codonw" button. What happens under netscape is there is a pause while the server at the site runs the app, after which you will get a page in your netscape browser with the results. With konqueror, this fails. There is no error message but you do not end up with the results page. If anyone actually gets konqueror to do this as it should, and as netscape does, I would appreciate information as to kde version, mandrake version, etc. I am running mandrake 8.0 with kde 2.1.1 with updates. On my home system, I have kde2.2alpha from cooker installed. Instead of nothing, I get a message telling me to enter either a filename or a sequence, not both even when all I did was paste in the sequence above, so there appears to be a problem with konqueror in both 2.1.1 and 2.2, though it is subtley different in each case. 2.1.1 doesn't give me any message at all (and no data analysis results). None of this happens under netscape, which works perfectly. -- Against stupidity, the gods themselves contend in vain.
