Update of /cvsroot/fink/dists/10.2/unstable/main/finkinfo/sci
In directory sc8-pr-cvs1:/tmp/cvs-serv30691
Added Files:
ncbitools-2.2.5-2.patch
Log Message:
add patch that chris forgot :)
--- NEW FILE: ncbitools-2.2.5-2.patch ---
--- ncbitools-20020426-0/LICENSE Wed Jun 26 19:23:12 2002
+++ ncbitools-20020426-1/LICENSE Tue Dec 11 17:00:00 2001
@@ -0,0 +1,109 @@
+
+Introduction
+
+ The GenInfo Software Toolbox is a set of software and data exchange
+specifications that are used by NCBI to produce portable, modular software for
+molecular biology. We make this software and specifications available to the
+community for use in its own right, or as a foundation for building other
+tools with similar properties. All software produced by NCBI and here
+provided includes the following copyright notice:
+
+ **************************************************************************
+ * *
+ * National Center for Biotechnology Information *
+ * Bldg. 38A, NIH, 8600 Rockville Pike, Bethesda, MD 20894 *
+ * *
+ * COPYRIGHT NOTICE *
+ * *
+ * This software/database is "United States Government Work" under the *
+ * terms of the United States Copyright Act. It was written as part of *
+ * the author's official duties as a Government employee and thus cannot *
+ * be copyrighted. This software/database is freely available to the *
+ * public for use without a copyright notice. Restrictions cannot be *
+ * placed on its present or future use. *
+ * *
+ * Although all reasonable efforts have been taken to ensure the accuracy *
+ * and reliability of the software and data, the National Library of *
+ * Medicine (NLM) and the U.S. Government does not and cannot warrant the *
+ * performance or results that may be obtained by using this software or *
+ * data. The NLM and the U.S. Government disclaims all warranties as to *
+ * performance, merchantability or fitness for any particular purpose. *
+ * *
+ * In any work or product derived from this material, proper attribution *
+ * of the author as the source of the software or data would be *
+ * appreciated. *
+ * *
+ **************************************************************************
+
+ In those cases where software is made available from other sources,
+other restrictions may apply.
+
+ It is available by anonymous ftp from ftp.ncbi.nih.gov. In the "toolbox"
+directory you will find the following:
+
+Directory Structure
+
+ These files are available for anonymous ftp from "ftp.ncbi.nih.gov".
+The directory structure is as follows:
+
+ toolbox - top level toolbox directory
+ ncbi_tools - NCBI software development toolkit and ASN.1
+specs
+ most current version (3.xx). FTP the toolkit
+from
+ this directory.
+ other_ncbi - various other tools made by ncbi
+ other_tools - a few ASN.1 tools not made by ncbi
+ vms_utils - VMS tools for untarring and uncompressing
+
+ncbi_tools
+
+ This is the NCBI portable software toolkit. A single compressed tar
+file contains all the code, ASN.1 specifications, and demo programs
+(including complete source code for Entrez). This file is:
+
+ncbi.tar.Z (Unix compressed tar file)
+ncbiZ.exe (DOS, Windows PKZIP file)
+ncbi.hqx (Mac self extracting archive)
+
+The contents of the files are the same except the UNIX version also includes
+the documentation. Documentation is available in the ncbi_tools/newdoc
+directory as MS Word file. A README in the files above explains installation.
+Hardcopy of the documentation and questions my be directed to
[EMAIL PROTECTED]
+
+vms_utils
+
+ This contains a set of utilities and instructions for VMS users to
+untar and uncompress the files in the other directories. Get this first if
+you are on VMS and read the instructions. Kindly maintained by Will Gilbert
+of Whitehead Institute. Also contains other VMS utilities such as drivers
+for ISO9660 CDROMS.
+==========================================================================
+in other_tools directory:
+
+isode
+
+ This is a very large system of tools from ISO for use in prototyping
+OSI applications. It includes many large tools in one file, and 5 volumes of
+PostScript documentation in the other file. The documentation is good for
+learning about OSI. There is an ASN.1 compiler which will give you the
+flavor of what can be done with these tools. This is not a simple or terribly
+efficient system.
+
+
+osikit
+
+ This is a set of tools from NIST (formerly the Bureau of Standards)
+to assist development of OSI applications. It includes the free value tool,
+which can read and validate an ASN.1 specification and produce an encoder and
+decoder for both the print form and basic encoding rules form. We find it
+very useful for checking syntax on both specifications and data objects. The
+limitation is that in the print form, the tool can only accept VisibleStrings
+all on one line, and less than 200 chars in length.
+
+
+asn_pmp
+
+ A parser for ASN.1 print files written by Peter Karp. It parses print
+files into S expressions which makes a simple, flexible way to input data
+objects. It does no checking on syntax or content. See the README for more
+details.
--- ncbitools-20020426-0/demo.fasta Thu Jun 27 13:49:01 2002
+++ ncbitools-20020426-1/demo.fasta Thu Jun 27 14:02:00 2002
@@ -0,0 +1,4 @@
+>demo polylinker
+CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA
+CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC
+CGTCGTTTTACAACGTCGTGACTGGGAAAAC
-------------------------------------------------------
This sf.net email is sponsored by:ThinkGeek
Welcome to geek heaven.
http://thinkgeek.com/sf
_______________________________________________
Fink-commits mailing list
[EMAIL PROTECTED]
https://lists.sourceforge.net/lists/listinfo/fink-commits
