Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci
In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv17712
Modified Files:
ncbitools.info ncbitools.patch
Log Message:
Fix for gcc4 and also fix for intel
Index: ncbitools.info
===================================================================
RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/ncbitools.info,v
retrieving revision 1.1
retrieving revision 1.2
diff -u -d -r1.1 -r1.2
--- ncbitools.info 20 Jan 2006 20:30:40 -0000 1.1
+++ ncbitools.info 30 Mar 2006 06:32:45 -0000 1.2
@@ -1,18 +1,15 @@
Package: ncbitools
Version: 2.2.6
-Revision: 3
-Architecture: powerpc
+Revision: 1003
Source: ftp://ftp.ncbi.nlm.nih.gov/toolbox/ncbi_tools/old/20030421/ncbi.tar.gz
SourceRename: %n-%v.tar.gz
NoSourceDirectory: true
Source2: mirror:sourceforge:fink/vector.Z
Source-MD5: 96208e10f92b2163f5dcc3c5cf74dd44
Source2-MD5: 331aa865cc6267d5b0b5e92e669ce5a2
-BuildDepends: gcc3.3
Patch: %n.patch
PatchScript: <<
perl -pi -e 's/(FSLockRange|FSUnlockRange)/MF_\1/g' `grep -lri lockrange .`
- perl -pi -e 's/ cc / gcc-3.3 /' ncbi/platform/darwin.ncbi.mk
<<
RuntimeVars: <<
BLASTDB: /data/blastdb
@@ -85,9 +82,15 @@
dmacks un-nested some function declarations, removed local versions
of functions now available in Carbon, and renamed some functions
that were added to Carbon in 10.4 but are not certain to be the same
- as the local ones of the same name. There are still some
- static-follows-non-static problems on gcc4, which is why we force
- use of the gcc-3.3 compiler.
+ as the local ones of the same name.
+
+ dmacks removed some extern'ed prototypes from some .h since all the
+ .c that use them already have their own prototype of it that is
+ static instead of extern (gcc4 requirement).
+
+ dmacks: intel is little-endian, so must hack GetKeys in vbwndws.c
+ but I don't know what keysym is wanted. So we'll just put in a
+ sleep() for now.
<<
Maintainer: Richard Graul <[EMAIL PROTECTED]>
Homepage: http://www.ncbi.nlm.nih.gov/BLAST/
Index: ncbitools.patch
===================================================================
RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/ncbitools.patch,v
retrieving revision 1.1
retrieving revision 1.2
diff -u -d -r1.1 -r1.2
--- ncbitools.patch 20 Jan 2006 20:30:40 -0000 1.1
+++ ncbitools.patch 30 Mar 2006 06:32:46 -0000 1.2
@@ -119,6 +119,30 @@
+CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA
+CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC
+CGTCGTTTTACAACGTCGTGACTGGGAAAAC
+diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salsap.h
ncbitools-2.2.6/ncbi/api/salsap.h
+--- ncbitools-2.2.6.orig/ncbi/api/salsap.h 1999-11-24 16:24:28.000000000
-0500
++++ ncbitools-2.2.6/ncbi/api/salsap.h 2006-03-30 00:55:23.000000000 -0500
+@@ -86,7 +86,7 @@
+
+ NLM_EXTERN Pointer LIBCALL FindSeqAlignInSeqEntry (SeqEntryPtr sep, Uint1
choice);
+
+-NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1 choice);
++//NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1
choice);
+
+ NLM_EXTERN Boolean LIBCALL is_dim1seqalign (SeqAlignPtr salp);
+
+diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salutil.h
ncbitools-2.2.6/ncbi/api/salutil.h
+--- ncbitools-2.2.6.orig/ncbi/api/salutil.h 1999-09-06 20:19:24.000000000
-0400
++++ ncbitools-2.2.6/ncbi/api/salutil.h 2006-03-30 00:56:29.000000000 -0500
+@@ -120,7 +120,7 @@
+ NLM_EXTERN SeqIdPtr ValNodeSeqIdListDup (ValNodePtr id_list);
+ NLM_EXTERN CharPtr PNTR SeqIdListToCharArray (SeqIdPtr id_list, Int2 n);
+
+-NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre, SeqIdPtr
sip, SeqIdPtr next);
++//NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre,
SeqIdPtr sip, SeqIdPtr next);
+ NLM_EXTERN BioseqPtr BioseqReplaceID (BioseqPtr bsp, SeqIdPtr newsip);
+ NLM_EXTERN SeqEntryPtr SeqEntryReplaceSeqID (SeqEntryPtr source_sep,
SeqIdPtr sip);
+ /*********************************************************
diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c
ncbitools-2.2.6/ncbi/corelib/ncbimisc.c
--- ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c 2002-11-06
16:25:10.000000000 -0500
+++ ncbitools-2.2.6/ncbi/corelib/ncbimisc.c 2005-12-29 12:01:28.000000000
-0500
@@ -173,3 +197,23 @@
host_basic_info_data_t hinfo;
mach_msg_type_number_t hinfo_count = HOST_BASIC_INFO_COUNT;
kern_return_t rc;
+diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/vibrant/vibwndws.c
ncbitools-2.2.6/ncbi/vibrant/vibwndws.c
+--- ncbitools-2.2.6.orig/ncbi/vibrant/vibwndws.c 2003-04-09
14:16:53.000000000 -0400
++++ ncbitools-2.2.6/ncbi/vibrant/vibwndws.c 2006-03-30 00:28:36.000000000
-0500
+@@ -6328,12 +6328,16 @@
+ */
+ /* #ifdef OS_MAC */
+ #ifdef WIN_MAC
++#if TARGET_RT_LITTLE_ENDIAN
++ sleep(5);
++#else
+ KeyMap keys;
+
+ GetKeys (keys);
+ if ((keys [1] & 1) != 0) {
+ Nlm_GetSet ();
+ }
++#endif /* TARGET_RT_LITTLE_ENDIAN */
+ #endif
+ #ifdef WIN_MSWIN
+ if (GetAsyncKeyState(VK_SHIFT) & 0x8000)
-------------------------------------------------------
This SF.Net email is sponsored by xPML, a groundbreaking scripting language
that extends applications into web and mobile media. Attend the live webcast
and join the prime developer group breaking into this new coding territory!
http://sel.as-us.falkag.net/sel?cmd=lnk&kid=110944&bid=241720&dat=121642
_______________________________________________
Fink-commits mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/fink-commits
