Update of /cvsroot/fink/experimental/beren12/finkinfo/net
In directory sc8-pr-cvs5.sourceforge.net:/tmp/cvs-serv7797/net
Modified Files:
.cvsignore
Added Files:
c3270.info ncbitools.patch
Log Message:
sync
--- NEW FILE: ncbitools.patch ---
diff -Nurd -x'*~' ncbitools-2.2.6.orig/LICENSE ncbitools-2.2.6/LICENSE
--- ncbitools-2.2.6.orig/LICENSE 1969-12-31 19:00:00.000000000 -0500
+++ ncbitools-2.2.6/LICENSE 2005-12-29 00:24:13.000000000 -0500
@@ -0,0 +1,109 @@
+
+Introduction
+
+ The GenInfo Software Toolbox is a set of software and data exchange
+specifications that are used by NCBI to produce portable, modular software for
+molecular biology. We make this software and specifications available to the
+community for use in its own right, or as a foundation for building other
+tools with similar properties. All software produced by NCBI and here
+provided includes the following copyright notice:
+
+ **************************************************************************
+ * *
+ * National Center for Biotechnology Information *
+ * Bldg. 38A, NIH, 8600 Rockville Pike, Bethesda, MD 20894 *
+ * *
+ * COPYRIGHT NOTICE *
+ * *
+ * This software/database is "United States Government Work" under the *
+ * terms of the United States Copyright Act. It was written as part of *
+ * the author's official duties as a Government employee and thus cannot *
+ * be copyrighted. This software/database is freely available to the *
+ * public for use without a copyright notice. Restrictions cannot be *
+ * placed on its present or future use. *
+ * *
+ * Although all reasonable efforts have been taken to ensure the accuracy *
+ * and reliability of the software and data, the National Library of *
+ * Medicine (NLM) and the U.S. Government does not and cannot warrant the *
+ * performance or results that may be obtained by using this software or *
+ * data. The NLM and the U.S. Government disclaims all warranties as to *
+ * performance, merchantability or fitness for any particular purpose. *
+ * *
+ * In any work or product derived from this material, proper attribution *
+ * of the author as the source of the software or data would be *
+ * appreciated. *
+ * *
+ **************************************************************************
+
+ In those cases where software is made available from other sources,
+other restrictions may apply.
+
+ It is available by anonymous ftp from ftp.ncbi.nih.gov. In the "toolbox"
+directory you will find the following:
+
+Directory Structure
+
+ These files are available for anonymous ftp from "ftp.ncbi.nih.gov".
+The directory structure is as follows:
+
+ toolbox - top level toolbox directory
+ ncbi_tools - NCBI software development toolkit and
ASN.1 specs
+ most current version (3.xx). FTP the
toolkit from
+ this directory.
+ other_ncbi - various other tools made by ncbi
+ other_tools - a few ASN.1 tools not made by ncbi
+ vms_utils - VMS tools for untarring and
uncompressing
+
+ncbi_tools
+
+ This is the NCBI portable software toolkit. A single compressed tar
+file contains all the code, ASN.1 specifications, and demo programs
+(including complete source code for Entrez). This file is:
+
+ncbi.tar.Z (Unix compressed tar file)
+ncbiZ.exe (DOS, Windows PKZIP file)
+ncbi.hqx (Mac self extracting archive)
+
+The contents of the files are the same except the UNIX version also includes
+the documentation. Documentation is available in the ncbi_tools/newdoc
+directory as MS Word file. A README in the files above explains installation.
+Hardcopy of the documentation and questions my be directed to
[EMAIL PROTECTED]
+
+vms_utils
+
+ This contains a set of utilities and instructions for VMS users to
+untar and uncompress the files in the other directories. Get this first if
+you are on VMS and read the instructions. Kindly maintained by Will Gilbert
+of Whitehead Institute. Also contains other VMS utilities such as drivers
+for ISO9660 CDROMS.
+==========================================================================
+in other_tools directory:
+
+isode
+
+ This is a very large system of tools from ISO for use in prototyping
+OSI applications. It includes many large tools in one file, and 5 volumes of
+PostScript documentation in the other file. The documentation is good for
+learning about OSI. There is an ASN.1 compiler which will give you the
+flavor of what can be done with these tools. This is not a simple or terribly
+efficient system.
+
+
+osikit
+
+ This is a set of tools from NIST (formerly the Bureau of Standards)
+to assist development of OSI applications. It includes the free value tool,
+which can read and validate an ASN.1 specification and produce an encoder and
+decoder for both the print form and basic encoding rules form. We find it
+very useful for checking syntax on both specifications and data objects. The
+limitation is that in the print form, the tool can only accept VisibleStrings
+all on one line, and less than 200 chars in length.
+
+
+asn_pmp
+
+ A parser for ASN.1 print files written by Peter Karp. It parses print
+files into S expressions which makes a simple, flexible way to input data
+objects. It does no checking on syntax or content. See the README for more
+details.
diff -Nurd -x'*~' ncbitools-2.2.6.orig/demo.fasta ncbitools-2.2.6/demo.fasta
--- ncbitools-2.2.6.orig/demo.fasta 1969-12-31 19:00:00.000000000 -0500
+++ ncbitools-2.2.6/demo.fasta 2005-12-29 00:24:13.000000000 -0500
@@ -0,0 +1,4 @@
+>demo polylinker
+CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA
+CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC
+CGTCGTTTTACAACGTCGTGACTGGGAAAAC
diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/corelib/ncbithr.c
ncbitools-2.2.6/ncbi/corelib/ncbithr.c
--- ncbitools-2.2.6.orig/ncbi/corelib/ncbithr.c 2003-03-06 10:12:27.000000000
-0500
+++ ncbitools-2.2.6/ncbi/corelib/ncbithr.c 2005-12-29 00:29:02.000000000
-0500
@@ -2554,14 +2554,16 @@
}
-NLM_EXTERN Int4 NlmCPUNumber(void)
-{
#if defined(OS_UNIX_DARWIN)
#include <mach/mach.h>
#include <mach/mach_host.h>
#include <mach/host_info.h>
+#endif
+NLM_EXTERN Int4 NlmCPUNumber(void)
+{
+#if defined(OS_UNIX_DARWIN)
host_basic_info_data_t hinfo;
mach_msg_type_number_t hinfo_count = HOST_BASIC_INFO_COUNT;
kern_return_t rc;
Index: .cvsignore
===================================================================
RCS file: /cvsroot/fink/experimental/beren12/finkinfo/net/.cvsignore,v
retrieving revision 1.1
retrieving revision 1.2
diff -u -d -r1.1 -r1.2
--- .cvsignore 9 Nov 2005 14:18:07 -0000 1.1
+++ .cvsignore 31 May 2006 23:55:12 -0000 1.2
@@ -1 +1,5 @@
*~
+*.swp
+*.bak
+*.orig
+*.rej
--- NEW FILE: c3270.info ---
Package: bittornado
Version: 0.3.10
Revision: 11
Depends: python23
BuildDepends: python23
Source: http://www.bittornado.com/download/BitTornado-%v.tar.gz
Source-MD5: 356213bc5964377a21cd9c56cd130c0d
SourceDirectory: BitTornado-CVS
PatchScript: <<
#!/bin/sh
patch -p1 < %a/%n.patch
for patch in $(ls debian/patches/*.dpatch); do
patch -p1 < $patch
done
perl -pi -e 's|\#\!/usr/bin/env python|\#\!%p/bin/python2.3|' *.py
<<
CompileScript: apt-get moo || true
InstallScript: <<
python2.3 ./setup.py install --prefix=%i
install -d %i/share/mimelnk/application
install -D -m644 debian/bittornado.desktop
%i/share/applications/bittornado.desktop
install -D -m644 debian/bittornado.xpm %i/share/pixmaps/bittornado.xpm
chmod 755 %i/lib/python2.3/site-packages/BitTornado/launchmanycore.py
cp %i/bin/btmakemetafile.py %i/lib/python2.3/site-packages/BitTornado
cp %i/bin/btcompletedir.py %i/lib/python2.3/site-packages/BitTornado
# Remove the .py from the end of each of these and add .bittornado
# so that the alternatives system can work
( cd %i/bin && \
for i in btdownloadgui btdownloadheadless bttrack btmakemetafile \
btlaunchmany btcompletedir btcompletedirgui \
btdownloadcurses btlaunchmanycurses btreannounce btrename \
btshowmetainfo; \
do mv $i.py $i.bittornado; done )
# Remove the .py from the end of each of these, the following are not
# included in bittorrent, so they are not renamed to having the
# suffix of .bittornado
( cd %i/bin && \
for i in btcopyannounce btsethttpseeds btmaketorrentgui; \
do mv $i.py $i; done )
# Install manpages
mkdir -p %i/share/man/man1
cp debian/*.1 %i/share/man/man1
<<
DocFiles: LICENSE.txt MANIFEST.in README.txt ipranges.portugal.txt docs/FAQ.txt
docs/IMPORTANT-multitracker-readme.txt docs/README-Psyco.txt docs/credits.txt
docs/multitracker-spec.txt docs/webseed-spec.txt debian/NEWS
debian/README.Debian debian/changelog
Description: bittorrent client with enhanced curses interface
DescDetail: <<
bittorrent is a tool for distributing files. Whenever more than one
person is downloading at once they send pieces of the file(s) to each
other, thus relieving the central server's bandwidth burden. Even with
many simultaneous downloads, the upload burden on the central server
remains quite small, since each new downloader introduces new upload
capacity.
BitTornado is the next generation bittorrent client built on
the original BitTorrent. This client features an enhanced
console/curses mode, lots of new features under the hood, and is
generally one of the most advanced clients out there. Get this if you
need to limit your bandwidth, or you want more control of your
torrents. It does everything the original bittorrent does, plus more...
This package only contains the curses interfaces, install the package
bittornado-gui to get the GUI components
<<
Splitoff: <<
Package: %N-gui
Depends: wxpython-py23, python23, bittornado (>= %v-10)
Files: bin/*gui* share/pixmaps share/man/man1/*gui*.1 share/applications
DocFiles: debian/copyright debian/NEWS debian/changelog
Description: bittorrent client with enhanced GUI interface
DescDetail: <<
bittorrent is a tool for distributing files. It's extremely easy to
use - downloads are started by clicking on hyperlinks. Whenever more
than one person is downloading at once they send pieces of the
file(s) to each other, thus relieving the central server's bandwidth
burden. Even with many simultaneous downloads, the upload burden on
the central server remains quite small, since each new downloader
introduces new upload capacity.
BitTornado is the next generation bittorrent client built on
the original BitTorrent. This client features an enhanced GUI, lots
of new features under the hood, and is generally one of the most
advanced clients out there. Get this if you need to limit your
bandwidth, or you want more control of your torrents. It does
everything the original bittorrent does, plus more...
<<
PostInstScript: <<
# postinst script for bittorrent
case "$1" in
configure)
for i in btcompletedirgui btdownloadgui ; do
update-alternatives \
--install %p/bin/$i $i %p/bin/$i.bittornado 120 \
--slave %p/share/man/man1/$i.1 $i.1 %p/share/man/man1/$i.bittornado.1
done
;;
abort-upgrade|abort-remove|abort-deconfigure)
for i in btcompletedirgui btdownloadgui ; do
update-alternatives \
--install %p/bin/$i $i %p/bin/$i.bittornado 120 \
--slave %p/share/man/man1/$i.1 $i.1
%p/share/man/man1/$i.bittornado.1
done
;;
*)
echo "postinst called with unknown argument \`$1'" >&2
exit 1
;;
esac
<<
PreRmScript: <<
case "$1" in
remove|upgrade|deconfigure)
for i in btcompletedir btcompletedirgui btdownloadcurses btdownloadgui
btdownloadheadless btlaunchmany btlaunchmanycurses btmakemetafile btreannounce
btrename btshowmetainfo bttrack ; do
update-alternatives --remove $i %p/bin/$i.bittornado
done
;;
failed-upgrade)
;;
*)
echo "prerm called with unknown argument \`$1'" >&2
exit 1
;;
esac
<<
<<
DescPort: <<
Get the debian patch, apply and then make changes specific to fink
(@FINKPREFIX@)
Helpful to keep a diff from clean source+debian patches -> final diff
<<
PostInstScript: <<
case "$1" in
configure)
for i in btcompletedir btdownloadcurses btdownloadheadless btlaunchmany
btlaunchmanycurses btmakemetafile btreannounce btrename btshowmetainfo bttrack
; do
update-alternatives \
--install %p/bin/$i $i %p/bin/$i.bittornado 120 \
--slave %p/share/man/man1/$i.1 $i.1
%p/share/man/man1/$i.bittornado.1
done
;;
abort-upgrade|abort-remove|abort-deconfigure)
for i in btcompletedir btcompletedirgui btdownloadcurses btdownloadgui
btdownloadheadless btlaunchmany btlaunchmanycurses btmakemetafile btreannounce
btrename btshowmetainfo bttrack ; do
update-alternatives \
--install %p/bin/$i $i %p/bin/$i.bittornado 120 \
--slave %p/share/man/man1/$i.1 $i.1
%p/share/man/man1/$i.bittornado.1
done
;;
*)
echo "postinst called with unknown argument \`$1'" >&2
exit 1
;;
esac
<<
PreRmScript: <<
case "$1" in
remove|upgrade|deconfigure)
for i in btcompletedir btcompletedirgui btdownloadcurses btdownloadgui
btdownloadheadless btlaunchmany btlaunchmanycurses btmakemetafile btreannounce
btrename btshowmetainfo bttrack ; do
update-alternatives --remove $i %p/bin/$i.bittornado
done
;;
failed-upgrade)
;;
*)
echo "prerm called with unknown argument \`$1'" >&2
exit 1
;;
esac
<<
License: BSD
Maintainer: Chris Zubrzycki <[EMAIL PROTECTED]>
Homepage: http://www.bittornado.com/
_______________________________________________
Fink-commits mailing list
Fink-commits@lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/fink-commits
