Hello,

I am still working on trying to solve the failures that I have with some 
functional tests. I have been working today on Interval2Maf_pairwise1 
functional test from the 'Extract Pairwise MAF blocks' tool 
(maf/interval2maf_pairwise.xml) and made some progress but I still do have a 
failure due to output differences.

I would like to know if there are some documentation or even better some 
scripts for uploading tool's data locally in order to pass all functional 
tests. I've been looking into the wiki and within the Galaxy source code 
without much success.

Below is what I have done and the output of the functional test.

# install bx-python
# edit ~/galaxy/tool-data/maf_pairwise.loc
# Pairwise (hg17,fr1)     PAIRWISE_hg17_fr1       hg17,fr1        hg17,fr1      
  
/data_ls/galaxy/data/hg17/align/chr1.maf,/data_ls/galaxy/data/hg17/align/chrX.maf
# download pairwise alignment
cd /data_ls/galaxy/data/hg17/align
wget ftp://hgdownload.cse.ucsc.edu/goldenPath/hg17/multiz8way/chr1.maf.gz
gunzip chr1.maf.gz
maf_build_index.py -s hg17 chr1.maf
wget ftp://hgdownload.cse.ucsc.edu/goldenPath/hg17/multiz8way/chrX.maf.gz
gunzip chrX.maf.gz
maf_build_index.py -s hg17 chrX.maf
# run functional test
./run_functional_tests.sh -id Interval2Maf_pairwise1

test_tool_000000 (functional.test_toolbox.TestForTool_Interval2Maf_pairwise1)
Extract Pairwise MAF blocks ( Interval2Maf_pairwise1 ) > Test-1 ... 
galaxy.web.framework DEBUG 2012-02-23 18:13:09,955 Error: this request returned 
None from get_history(): http://localhost:9435/
galaxy.web.framework DEBUG 2012-02-23 18:13:10,000 Error: this request returned 
None from get_history(): http://localhost:9435/
galaxy.web.framework DEBUG 2012-02-23 18:13:10,059 Error: this request returned 
None from get_history(): http://localhost:9435/user/logout
galaxy.web.framework DEBUG 2012-02-23 18:13:10,097 Error: this request returned 
None from get_history(): http://localhost:9435/
galaxy.tools.actions.upload_common INFO 2012-02-23 18:13:11,226 tool upload1 
created job id 1
galaxy.jobs DEBUG 2012-02-23 18:13:19,603 (1) Working directory for job is: 
/opt/local/home/webapp/galaxy/database/job_working_directory/000/1
galaxy.jobs DEBUG 2012-02-23 18:13:19,603 dispatching job 1 to local runner
galaxy.jobs INFO 2012-02-23 18:13:19,735 job 1 dispatched
galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:19,945 executing: python 
/opt/local/home/webapp/galaxy/tools/data_source/upload.py 
/opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf         
1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat
galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:20,828 execution finished: 
python /opt/local/home/webapp/galaxy/tools/data_source/upload.py 
/opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf         
1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat
galaxy.jobs DEBUG 2012-02-23 18:13:21,002 job 1 ended
galaxy.jobs DEBUG 2012-02-23 18:13:25,288 (2) Working directory for job is: 
/opt/local/home/webapp/galaxy/database/job_working_directory/000/2
galaxy.jobs DEBUG 2012-02-23 18:13:25,288 dispatching job 2 to local runner
galaxy.jobs INFO 2012-02-23 18:13:25,411 job 2 dispatched
galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:27,379 executing: python 
/opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 
--chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 
--interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat 
--output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat 
--indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc
galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:28,743 execution finished: 
python /opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 
--chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 
--interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat 
--output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat 
--indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc
galaxy.jobs DEBUG 2012-02-23 18:13:30,404 job 2 ended
base.twilltestcase INFO 2012-02-23 18:13:30,863 ## files diff on 
/opt/local/home/webapp/galaxy/test-data/Interval2Maf_pairwise_out.maf and 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmplBoXcFInterval2Maf_pairwise_out.maf 
lines_diff=0, found diff = 5256
---------------------- >> begin tool stdout << -----------------------
968 MAF blocks extracted for 1 regions.

----------------------- >> end tool stdout << ------------------------

---------------------- >> begin tool stderr << -----------------------

----------------------- >> end tool stderr << ------------------------

FAIL

======================================================================
FAIL: test_tool_000000 
(functional.test_toolbox.TestForTool_Interval2Maf_pairwise1)
Extract Pairwise MAF blocks ( Interval2Maf_pairwise1 ) > Test-1
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/opt/local/home/webapp/galaxy/test/functional/test_toolbox.py", line 
162, in test_tool
    self.do_it( td )
  File "/opt/local/home/webapp/galaxy/test/functional/test_toolbox.py", line 
97, in do_it
    self.verify_dataset_correctness( outfile, hid=elem_hid, 
maxseconds=testdef.maxseconds, attributes=attributes )
  File "/opt/local/home/webapp/galaxy/test/base/twilltestcase.py", line 715, in 
verify_dataset_correctness
    raise AssertionError( errmsg )
AssertionError: History item 2 different than expected, difference (using diff):
--- local_file
+++ history_data
@@ -1,49 +1,5209 @@
 ##maf version=1
-a score=10458
-s hg17.chrX   3816458 525 - 154824264 
tGATGCACGTTTTCTCTTTTCATACTCATCTT--CAGTTATTCCTTGACACAAACCTGGTTA---CTAGTGCTATTGGCTACATGGCCCCTGTGCCTTAACTTCCCTCATGGCTCCTCCTCCCTGCAGCCTCTGAAGGTTCTCTGTGTAATGAATT--AATTAGCTTTGCTTTTTTCTCCCTTTCCCCC-----CCTCTTTTTCCTGGCCTCT---------AGAAGAAAACACCAGCAGCCCCAGCAAAGAAAACCAGCACTACCTTCAACATCGTGGGGACCACCTATCCCATCAACCTGGCCAAGGACACTGAATTTTCCACCATCTCCAAGGGCGCTGCTCCCAGTGCCTCCTCAACCCCAACAATCATTGCTTCACCCAAGGCCACCTACGTGCAGGACAGCCCGACTGAGACCAAGA---CCTACAACAGTGTCAGCAAGGTTGACAAAATTTCCCGCATCATCTTTCCTGTGCTCTTTGCCATATTCAATCTGGTCTATTGGGCCACATATGTCAACCGGGAGTCAGCTATCAAGGGCATGA
-s fr1.chrUn 343715247 529 - 349519338 
TGGTCAACATTTTTTTCTTTTCTACTTTTCTTTTCAGGAACCGTTTCAGGCTAACATGGCCAGGATTAAAGATAT-GGTTAGGCTTTTGTTTTGTTCTTGTGTGTGTCGTGTCTCGTGGT----GTTGCTTCTATTTCCTCTTCATGAGTTCAAATGGAAGTATTGTTAAGTTTGTTGCCCCCGACCCTAACGACCTCTGCTTTATGGCCTCTTCTCTTTTCAGAGGAGAGAATCTGAGAATCTGACCAAAAAGACGAACAACACCTTCAACATCGTCGGGACGACCTACGCCATCAACGTGGCGAAGGACCAGGGCTTAACCACCATCTCCAAAAGCGCCACCACCGGCGCGCC----GGCCAAACAGCACTACCTGCACAAAA-----------TGGACGACCCCTACACAGAGGCCAAGAAATCCTACAACCGAGTCAGCATAGTGGACAAAATATCACGCATCATTTTCCCAGTTCTGTTCTTCATCTTCAACTTGGGCTACTGGGCCACATATATCAACAGGAAGCCCATTATTATGAACGCGA
-
-a score=12779
-s hg17.chrX   3795168 357 - 154824264 
aGGGCCATTTTGAGTGGGGTAAAGCTTCTCCTTTCAAATAGGAAA----TTAGTGATTTCATCG--AATAAGC-------TCTCAATGTCTTCCAGTTGCAACTGGTTCTCATCTTTCCTCT----CCTCAGGTGTCACCACTGTGCTTACCATGACCACCTTGAGTATCAGTGCCAGAAATTCCTTACCTAAAGTGGCATATGCGACGGCCATGGACTGGTTCATAGCCGTCTGTTATGCCTTTGTATTTTCTGCACTGATTGAATTTGCCACTGTCAACTATTTCACCAAGCGGAGTTGGGCTTGGGAAGGCAAGAAGGTGCCAGAGGCCCTGGAGATGAAGGTGAGATA----TAGCAAAAGAGAAACTGAGAAG
-s fr1.chrUn 343710815 364 - 349519338 
TGAGCCAATTT--------TGAAGTGACAATTTTCAAATGTGCCACATTTTAGTAGCAGCAAAGTCAGAAAGCGACTTTTCCTCTACATCACTTCTCTGATCTGTGTTCTGATGTTTTCCTTTCATCCTCAGGGGTCACCACTGTGCTTACCATGACCACCCTGAGCATCAGTGCTAGAAACTCCCTCCCTAAGGTGGCCTACGCCACCGCCATGGACTGGTTCATGGCGGTGTGCTACGCCTTTGTCTTCTCTGCCTTGATTGAGTTTGCGACGGTCAACTACTTCACCAAACGCAGCTGGGCATGGGATGGGAAAAA------AGAGGGCATGGAAATAAGGGTGAGTGATTTTTAATCAAATATATACTGATACG
-
-a score=10363
-s hg17.chrX   3787425 174 - 154824264 
TACTCTCTCTTTAGGAGAATATGTCGTCATGACAACCCACTTCCATCTCAAGCGAAAAATTGGCTACTTTGTGATCCAGACCTACTTGCCATGTATCATGACTGTCATTCTGTCACAAGTGTCGTTCTGGCTCAACAGAGAGTCTGTTCCTGCCCGTACAGTCTTTGGTGAGTG
-s fr1.chrUn 343708230 174 - 349519338 
TCCTCCCGCTGCAGGCGAATATGTTGTGATGACAACATATTTCCATTTGAAAAGGAAAATTGGCTATTTCGTGATTCAAACCTACCTCCCGTGCATCATGACTGTCATTCTGTCTCAAGTCTCCTTCTGGCTGAACCGAGAATCGGTCCCTGCTCGCACCGTGTTCGGTGAGTG
-
-a score=31
-s hg17.chrX  3787284 100 - 154824264 
ATTTTGTGATTATTAAAGGGCTCTAGTTATATGAACTTGGGAGATGCTGGAATATTGAATATAAG----ATTAAAGAGCTTTGTGAAT--------TGAATT-----GGGGCCCAAC
-s fr1.chrUn 62078707 109 - 349519338 
AGTTTGTGAGGCCTAAATGCCAAAAGT-------ACTTGA-ACAGGCTTAAGAATGGATCATGAATTTTCTTAAATAAATCTGTTAATCCAGAAAGTAAACTCTGGGGGGGTCCAGA
-
-a score=4963
-s hg17.chrX   3776942 285 - 154824264 
aCTTCAGTTGAAGACAGACCACATACCCAGAACTCTTTGAAGATGGAAGTTTTATTTCGATCTCATTTGAGTTTAGTATCAAGGGTAATCATTCTCCATTTCCTTCAACTTCTCTTTATTGACCCTTCTCTGCC--TTAGATGCCTATACAACAGCTGAAGTGGTTTATTCTTGGACTCTCGGAAAGAACAAATCCGTGGAAGTGGCACAGGATGGTTCTCGCTTGAACCAGTATGACCTTTTGGGCCATGTTGTTGGGACAGAGATAATCCGGTCTAGTACAGGTA
-s fr1.chrUn 343707053 283 - 349519338 
AACTTAAATCAACACCAAGTAAAGGCAAAGAATCTTTTAAACTAAGAA----TCTATTAAACTAGATAAACTAAAGCATCGACACTGACGCGTTGATCTGTCATCCACGTTTCCCCTGTTTCCTTTCCTTCTCCATCTAGACGCTTACACCAACAATGAGGTGATTTACCTGTGGACTCAGGGGGACGAGAGGTCTGTGTCTGTCGCAGAGGACGGCTCCAGGCTGAACCAGTATGATTTACTGGGACACGTTATTGGCAAAGAAACCATCAGCTCCAGCACAGGTA
-
-a score=5912
-s hg17.chrX   3760375 93 - 154824264 
TTAGGTTAACAATTCATGCTGAGTGTCCCATGCATTTGGAAGATTTTCCCATGGATGTGCATGCCTGCCCACTGAAGTTTGGAAGCTGTATGT
-s fr1.chrUn 343706399 93 - 349519338 
TCAGGTTGACCATCCACGCTGAGTGCCCCATGCACCTGGAGGACTTCCCCATGGACTCGCACGCCTGTCCTCTCAAGTTTGGAAGTTGTAAGT
-
-a score=4332
-s hg17.chrX   3733405 476 - 154824264 
ATCAAGGAGAATTTGGGGAAACAGAGCATTAGGGAAGGAATAGATGGAAGAGAGGCATGCTTGTAATAAATTATAGGAAAGAGAAGAGTTTGAAAAAGAGATAAGAGTTCACACAATTGTGGAAAGAATGGAGTGGAGTATATGTAAACAGAAAAGAAGCTGTATGGAATGAGGTGGATGGAGGGACAGAATAATGAGGAGGAGAT---GTGGATGGGCAGAAGACAGTAAGCAAATGGAAGAGAAGCAAGA-----GGAAGGAGAGAGTAATGGGCAGGAAAGGATCTGAACCCAGTAGAGATTGCAAATAGTGAGGAGAAATAGAGAATGAATGAAAAGAACAGG--ATAGAGGAGAAACAACAATAAAAGGAATAAAGCATAGAGAATAGGTTTAAGTTTTGGAGGAGGGATAGAGAA-----GAGAGAAGAAAGGAGAGAGGATGGGAATATTGAAATACAAAAAAATAGAAGGTGCAGGTTGAGGA
-s fr1.chrUn 303515824 444 + 349519338 
AACACGGAATATGGAGGGAAAACGGGGAATATGGAGGGAACAG--GGAATATGG-------------------TGGGAACACAGAGGGAATATGGAGGGAACACGGG-------GAATATGGAGGGAA---AACGGGGAATATGGAGGGAACGGGGAATATGGAGGGAACGAGGAATATGGAGGGAACGGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACAGGGAAT--ATGGAGGGAACGGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATAT--------------GGAGGGAACGAGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACGGGGTACTCAGTGAGAA
-
-a score=719
-s hg17.chrX   3731355 108 - 154824264 
TATGTAAGTAGAATGCAGTCAAGAAACTTGTAGGTGGATAGGTAGAGGCAGAAGGAAGAGAGGAAGGACGTTCTAGACAGAGAAAACCAAGTGAGCAGTTGCAGGGAA
-s fr1.chrUn 303515724  91 + 349519338 
TATGGAGGGAACACG------GGGAATATGGAGG-GAATATAGAGGGGAGACGGGGAATATGGAGGGA------ACACGGGGAATATGGAGGGAACA----CAGGGAA
-
-a score=3647
-s hg17.chrX   3730591 447 - 154824264 
CAAGGAAAAAAGGATAATACTTCAGAGAGAAGTTGGATGAGAGATGGGAGGAA--AAATGAACATAGAGGAGAAATGAGCATAGAGTGGAGGATAAAATAATGAAGAAGGAAAGTGGATAGAAGTGGGAAGATGAGGGTCAAGAGGGGAGGAGAAGACTAATTACACAGAGTACATAGAGGCATGTATATTGGAGAAATGAGAATGGTGAAAAGAAAGAGAGTATGAGAAGAGAGGACAAAAAGAGTAGAGAAGTTGAGAAGACAAAGGATAAGATGGTGTAAAATAAAGAAGCTAGATTAGATATTAGGATATTCTAAAGAGATAGGCGAATATAATGAAGTGGATGTAGTAGATGGGAATAAAGAGGAAAAGACATAGAGAAGTAGGGGAAGGGACATGGGAGGAGATGAACAAGAGGGAGGGAAATTGTAGACGAAAGAAAGAGAA
-s fr1.chrUn 303515378 346 + 349519338 
CACGGGGAATATGGCGGGAACACAGAGGGAATATGGAGGGAACACGGGGAATATGGAGGGAATATAGAGGGGAGACGGG--GAATATGGAGGG-AACATGGGGAATATGGAGGGAATATAGA---GGGGAGACGGGGAATATGGAGGGA--------------ACACGGGGAATATGGAGG---GAACACAGG------GAATATGGCGGGAACACAGGGAATATG----GAGGGAACACGGGGAATATGGAGG----GAACACAGGGAATATGGAGG----AAATATAGAGGGAAAACGGGAAAT------------------------------ATGGAGGGAATATGGT----GGGAACACAGGGAATA----------------TGGAGGGAACACGGGG----------AATATGGAGGGAA--TATAGAGGGGAGACGGGGAA
-

-------------------- >> begin captured stdout << ---------------------

Uploaded file:  8.bed , ftype:  auto , extra:  {'value': '8.bed', 'children': 
[], 'dbkey': 'hg17', 'format': 'bed'}

form 'tool_form' contains the following controls ( note the values )
control 0: <HiddenControl(tool_id=Interval2Maf_pairwise1) (readonly)>
control 1: 
<HiddenControl(tool_state=800255ad616630373336623066396637653065636434343038306566306666326436306338613664643932303a37623232356635663730363136373635356635663232336132303330326332303232366436313636353437393730363532323361323032323563323235303431343935323537343935333435356636383637333133373566363637323331356332323232326332303232363936653730373537343331323233613230323233313232376471002e)
 (readonly)>
control 2: <SelectControl(input1=[*1])>
control 3: <SelectControl(mafType=[*PAIRWISE_hg17_fr1])>
control 4: <SubmitControl(runtool_btn=Execute) (readonly)>
page_inputs (0) {'mafType': ['PAIRWISE_hg17_fr1'], 'input1': ['8.bed']}

--------------------- >> end captured stdout << ----------------------
-------------------- >> begin captured logging << --------------------
galaxy.web.framework: DEBUG: Error: this request returned None from 
get_history(): http://localhost:9435/
galaxy.web.framework: DEBUG: Error: this request returned None from 
get_history(): http://localhost:9435/
galaxy.web.framework: DEBUG: Error: this request returned None from 
get_history(): http://localhost:9435/user/logout
galaxy.web.framework: DEBUG: Error: this request returned None from 
get_history(): http://localhost:9435/
galaxy.tools.actions.upload_common: INFO: tool upload1 created job id 1
galaxy.jobs: DEBUG: (1) Working directory for job is: 
/opt/local/home/webapp/galaxy/database/job_working_directory/000/1
galaxy.jobs: DEBUG: dispatching job 1 to local runner
galaxy.jobs: INFO: job 1 dispatched
galaxy.jobs.runners.local: DEBUG: executing: python 
/opt/local/home/webapp/galaxy/tools/data_source/upload.py 
/opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf         
1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat
galaxy.jobs.runners.local: DEBUG: execution finished: python 
/opt/local/home/webapp/galaxy/tools/data_source/upload.py 
/opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf         
1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat
galaxy.jobs: DEBUG: job 1 ended
galaxy.jobs: DEBUG: (2) Working directory for job is: 
/opt/local/home/webapp/galaxy/database/job_working_directory/000/2
galaxy.jobs: DEBUG: dispatching job 2 to local runner
galaxy.jobs: INFO: job 2 dispatched
galaxy.jobs.runners.local: DEBUG: executing: python 
/opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 
--chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 
--interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat 
--output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat 
--indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc
galaxy.jobs.runners.local: DEBUG: execution finished: python 
/opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 
--chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 
--interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat 
--output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat 
--indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc
galaxy.jobs: DEBUG: job 2 ended
base.twilltestcase: INFO: ## files diff on 
/opt/local/home/webapp/galaxy/test-data/Interval2Maf_pairwise_out.maf and 
/data_ls/tmp/tmpmYp_1L/database/tmp/tmplBoXcFInterval2Maf_pairwise_out.maf 
lines_diff=0, found diff = 5256
--------------------- >> end captured logging << ---------------------

----------------------------------------------------------------------
Ran 1 test in 21.136s

FAILED (failures=1)
functional_tests.py INFO 2012-02-23 18:13:31,065 Shutting down
functional_tests.py INFO 2012-02-23 18:13:31,065 Shutting down embedded web 
server
functional_tests.py INFO 2012-02-23 18:13:31,068 Embedded web server stopped
functional_tests.py INFO 2012-02-23 18:13:31,068 Shutting down app
galaxy.jobs INFO 2012-02-23 18:13:31,068 sending stop signal to worker thread
galaxy.jobs INFO 2012-02-23 18:13:31,068 job queue stopped
galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,069 sending stop signal to 
worker threads
galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,069 local job runner stopped
galaxy.jobs INFO 2012-02-23 18:13:31,069 sending stop signal to worker thread
galaxy.jobs INFO 2012-02-23 18:13:31,069 job stopper stopped
functional_tests.py INFO 2012-02-23 18:13:31,070 Embedded Universe application 
stopped
functional_tests.py INFO 2012-02-23 18:13:31,070 Cleaning up temporary files in 
/data_ls/tmp/tmpmYp_1L
galaxy.jobs INFO 2012-02-23 18:13:31,922 sending stop signal to worker thread
galaxy.jobs INFO 2012-02-23 18:13:31,923 job queue stopped
galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,923 sending stop signal to 
worker threads
galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,923 local job runner stopped
galaxy.jobs INFO 2012-02-23 18:13:31,923 sending stop signal to worker thread
galaxy.jobs INFO 2012-02-23 18:13:31,923 job stopper stopped
Exception OSError: (2, 'No such file or directory', 
'/data_ls/tmp/tmpmYp_1L/database/tmp/tmpcORjQS') in <bound method 
_TemporaryFileWrapper.__del__ of <closed file '<fdopen>', mode 'w' at 
0x2aa80780>> ignored
'run_functional_tests.sh help'                  for help
Note: galaxy test framework uses tool_conf.xml.sample, not tool_conf.xml

Thanks for your help.
Anne.

On 20 Feb 2012, at 18:25, Anne Pajon wrote:

> Hello,
>
> I am trying to have all functional tests on our production server 
> (galaxy-dist 6621:26920e20157f) run successfully but I do still have failures 
> that I do not know how to solve.
>
> Theses failures are related to unexpected differences probably due to 
> versions of software that have been upgraded recently.
>
> ( Extract genomic DNA 1 ) > Test-1
> ( Extract genomic DNA 1 ) > Test-2
> ( Extract genomic DNA 1 ) > Test-3
> ( Extract genomic DNA 1 ) > Test-4
> ( Extract genomic DNA 1 ) > Test-5
> ( GeneBed_Maf_Fasta2 ) > Test-1
> ( Interval2Maf1 ) > Test-1
> ( Interval2Maf1 ) > Test-3
> ( Interval_Maf_Merged_Fasta2 ) > Test-1
> ( Interval_Maf_Merged_Fasta2 ) > Test-2
> ( LinearRegression1 ) > Test-1
> ( XY_Plot_1 ) > Test-1
> ( cca1 ) > Test-1
> ( histogram_rpy ) > Test-1
> ( kpca1 ) > Test-1
> ( pca1 ) > Test-1
> ( pca1 ) > Test-2
> ( pca1 ) > Test-3
> ( plot_for_lda_output1 ) > Test-1
> ( qual_stats_boxplot ) > Test-1
>    AssertionError: History item 2 different than expected, difference (using 
> diff)
>
> ( gops_join_1 ) > Test-4
>   TwillAssertionError: code is 500 != 200
>
> I do also have failures due to missing data but I am struggling to find out 
> where to download them.
>
> ( gd_select_snps ) > Test-1
>   AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset 
> blurb: error
>   'bighorn' does not appear in location file 
> '/opt/local/home/webapp/galaxy/tool-data/gd.chrlens.loc'
>
> ( Annotation_Profiler_0 ) > Test-1
> ( Annotation_Profiler_0 ) > Test-2
>   AssertionError: Configuration error: Table directory is missing 
> (/opt/local/home/webapp/galaxy/tool-data/annotation_profiler/hg18)
>
> ( Interval2Maf_pairwise1 ) > Test-1
>   AssertionError: Attempting to set field 'mafType' to value 
> '['PAIRWISE_hg17_fr1']' in form 'tool_form' threw exception: cannot find 
> value/label "PAIRWISE_hg17_fr1" in list control
>
> ( maf_stats1 ) > Test-1
> ( maf_stats1 ) > Test-2
>   AssertionError: Attempting to set field 'maf_source_type|mafType' to value 
> '['8_WAY_MULTIZ_hg17']' in form 'tool_form' threw exception: cannot find 
> value/label "8_WAY_MULTIZ_hg17" in list control
>
> ( phastOdds_for_intervals ) > Test-1
>   AssertionError: Attempting to set field 'score_file' to value 
> '['/galaxy/data/phastOdds_precomputed/encode_SEP-2005_\
> tba.v2_phastOdds']' in form 'tool_form' threw exception: cannot find 
> value/label "/galaxy/data/phas..2_phastOdds" in li\
> st control
>
> ( aggregate_scores_in_intervals2 ) > Test-1
> ( aggregate_scores_in_intervals2 ) > Test-2
>   AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset 
> blurb: error
>
> ( gencode_partition1 ) > Test-1
>   Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
>   Error loading partitioning dataset.
>
> ( lda_analy1 ) > Test-1
>   AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset 
> blurb: error
>
> The last failure is related to genome diversity and the fact that it calls 
> python2.5. I've changed it to python for testing but the test still fails.
>
> ( gd_extract_flanking_dna ) > Test-1
> ( gd_extract_primers ) > Test-1
> ( gd_select_restriction_enzymes ) > Test-1
>   AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset 
> blurb: error
>   python2.5: command not found
>> if changed to python: ERROR: 'NoneType' object has no attribute 'rfind'
>
>
> Is there a way to fix these failures? Any help would be very much appreciated.
> Thanks,
> Anne.
>
> --
> Anne Pajon, Ph.D.
> Cancer Research UK - Cambridge Research Institute
> Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE
> anne.pa...@cancer.org.uk | +44 (0)1223 404 334
>
>

--
Anne Pajon, Ph.D.
Cancer Research UK - Cambridge Research Institute
Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE
anne.pa...@cancer.org.uk | +44 (0)1223 404 334



NOTICE AND DISCLAIMER
This e-mail (including any attachments) is intended for the above-named 
person(s). If you are not the intended recipient, notify the sender 
immediately, delete this email from your system and do not disclose or use for 
any purpose. 

We may monitor all incoming and outgoing emails in line with current 
legislation. We have taken steps to ensure that this email and attachments are 
free from any virus, but it remains your responsibility to ensure that viruses 
do not adversely affect you. 
Cancer Research UK
Registered in England and Wales
Company Registered Number: 4325234.
Registered Charity Number: 1089464 and Scotland SC041666
Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to