Salut, je te laisse envoyer ta question sur la liste galaxy-u...@listes.univ-lyon1.fr. Je répondrais à ta question directement (tes séquences doivent être d'une longeur de 30 nt minimum) sur la liste histoire que tout le monde puisse bénéficier du retour d'expérience,
Par ailleurs est tu inscrite sur cette liste de diffusion ?
Merci pour ta contribution,
A+
Vincent

Le 08/04/16 14:37, Rita Rebollo a écrit :


Bonjour,

J'essaye d utiliser cd-hit-dup avec une trentaines de sequences en format fasta ou fastq et ça ne marche pas. Il me donne une erreur. J ai aussi essayé sur le galaxy.edu et ça ne marche pas non plus. Saurais tu dire pourquoi s il te plait?

Mon petit fichier:

@HWI-ST132:549:C0FYUACXX:5:1101:1213:1910_1:N:0:TGGTTT
TGGTCGATGGTTATTCTGGATAACG
+
?@@DDDFFHH<DFHHIHIIAHIIFG
@HWI-ST132:549:C0FYUACXX:5:1101:1106:1958_1:N:0:TGGTTT
AAAGATGAATCGGTAGATCGAAAT
+
;??DDBDFFFFFFBEHGBHFF;EH
@HWI-ST132:549:C0FYUACXX:5:1101:1944:1926_1:N:0:TGGTTT
ATAACAGTGAATTTTGGACAGTG
+
?@?D;AD=CAD<,A:,8A<CA3C
@HWI-ST132:549:C0FYUACXX:5:1101:1981:1949_1:N:0:TGGTTT
TATTGCACATTCACCGGCCTGA
+
@@@FDFFFHH4DFGHHIGGHIG
@HWI-ST132:549:C0FYUACXX:5:1101:1943:1970_1:N:0:TGGTTT
GAGGTTCCGCAAATCTGCATATAGGG
+
=@@DADBDHHDHHGIIIIIAHIIIII
@HWI-ST132:549:C0FYUACXX:5:1101:1752:1987_1:N:0:TGGTTT
AGATATGTTTGATATTCTTGGTTG
+
@@@FDDFFHGDHHIJGJJJGEIII
@HWI-ST132:549:C0FYUACXX:5:1101:1995:1987_1:N:0:TGGTTT
GGAACCTCGATGGACGTGGAGTGC
+
;<?DDDDDH<AF:?A?EHFBFEF>
@HWI-ST132:549:C0FYUACXX:5:1101:2027:1925_1:N:0:TGGTTT
TGTATGCATTGCTTTCACTTCACAGA
+
@@@FFFDFHFDBHIJIIIJFHHGGEI
@HWI-ST132:549:C0FYUACXX:5:1101:2449:1910_1:N:0:TGGTTT
TGAAATGACTTATTGCCCAATGAATTGC
+
CCCFFFFFHHHHHJJJJJJIJIIJJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:2306:1925_1:N:0:TGGTTT
CGGAGAACGCAGAAAGGTGAGCT
+
BCCFFFEFHHFHHJJJJFHJIJJ
@HWI-ST132:549:C0FYUACXX:5:1101:2470:1932_1:N:0:TGGTTT
TGGATAGCTGCACAACCCGTGGTACC
+
@@@FFFDDHHHHHHI@HHHHGIEH9E
@HWI-ST132:549:C0FYUACXX:5:1101:2332:1938_1:N:0:TGGTTT
CCCCCTTAAGGTGAAGTAGGACCTGTC
+
CCCFFFFFGHDACFGIHJIGIIJJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:2327:1996_1:N:0:TGGTTT
TTGCCTGTCTGTATCTCAATTGAAGT
+
@@@DDDBDDDHFBBEHGHBHEHCEFH
@HWI-ST132:549:C0FYUACXX:5:1101:2539:1874_1:N:0:TGGTTT
CTTCTGTAGTTTGTAATTCTTTTAAA
+
1=DDFFFFHFHHIIIIIIEHIIIIII
@HWI-ST132:549:C0FYUACXX:5:1101:2585:1888_1:N:0:TGGTTT
TCTTTGGTGATTTTAGCTGTAT
+
CCCFFFFDHHHHHJJJJJJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:2506:1903_1:N:0:TGGTTT
TTGGATCGGAGTCTAAACTTTCGGAGC
+
CBCFFFFFHGHHHJIIJIJJJHIHGHG
@HWI-ST132:549:C0FYUACXX:5:1101:2534:1932_1:N:0:TGGTTT
TGCATGGATTCCAGAGCAGACTCGGC
+
@C@FFFFFGGBHDBGIIIGGHII?FB
@HWI-ST132:549:C0FYUACXX:5:1101:2629:1937_1:N:0:TGGTTT
TGCTTGGACTACATATGGTTGAGGGTTGTA
+
CCCFFFFFHHHHHJJJJJHGGGIJJJJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:2808:1935_1:N:0:TGGTTT
TGGATGTTTTCGAGAAAAAGAGAGA
+
CCCFFFFFHHHHGJJIJJIJIJIJI
@HWI-ST132:549:C0FYUACXX:5:1101:3230:1884_1:N:0:TGGTTT
CGGGTTCAATTCCCGGTATGGGAACCA
+
@BCFDDFFHHHHHJJJFHIJJJJJJJI
@HWI-ST132:549:C0FYUACXX:5:1101:3201:1901_1:N:0:TGGTTT
TTCCCTTTGGCTTGAGAAATGCTGC
+
BBBFFFFFHHGHHJJJIJJJIIJFI
@HWI-ST132:549:C0FYUACXX:5:1101:3202:1980_1:N:0:TGGTTT
AGAGTATTGCCAGCAAACTAATCGGTC
+
??@DADFFHGDHGICHGGHGGIIIIII
@HWI-ST132:549:C0FYUACXX:5:1101:3183:1994_1:N:0:TGGTTT
TCACTGGGCTTTGTTTATCTCA
+
@@@FFDABFAHHGHGIJIIGHI
@HWI-ST132:549:C0FYUACXX:5:1101:3490:1888_1:N:0:TGGTTT
AGGTTGAACAGGCGTTCTGAAATGAA
+
==?ADDFFHHHHHJGIHJJIIIJJIJ
@HWI-ST132:549:C0FYUACXX:5:1101:3286:1900_1:N:0:TGGTTT
TAGTACATCGGAACACAAGAGTCAAAAAAA
+
B@BFFFFFHHHHHIJJJIJIIDHHIIJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:3389:1907_1:N:0:TGGTTT
TTATTTCGCTCGCTACTGATTGCAG
+
???DDD4A@D;@CEEC+22AA+ACE
@HWI-ST132:549:C0FYUACXX:5:1101:3323:1917_1:N:0:TGGTTT
TTTGGATTGGCTACCTCTGGGATTGGGA
+
111==2AB3CD<C;F@HDGEGBGEAD?C
@HWI-ST132:549:C0FYUACXX:5:1101:3398:1919_1:N:0:TGGTTT
TTCGTCGAAGATACAGAACTGTTATT
+
?@?DDDDFHGHGFEHIGGGIGHJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:3538:1907_1:N:0:TGGTTT
CGTTACTCTGCCCTTTCGCGACCCAGAA
+
@@@FFFFFHHHHHJJJJJJJIJJJIJGG
@HWI-ST132:549:C0FYUACXX:5:1101:3531:1929_1:N:0:TGGTTT
AAAAGAGTCGGACTCCTATTGTG
+
??@DDDFFHHFFHIHEGIHI@BH
@HWI-ST132:549:C0FYUACXX:5:1101:3648:1970_1:N:0:TGGTTT
TGGAAGACTAGTGATTTTGTTGTT
+
CCCFFFFFHHHHHEHJJJIJJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:3662:1998_1:N:0:TGGTTT
ATGGACTGAGAACCGGAATTTTT
+
CCCFFFFFHHHHHJJJIJIIJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:3752:1916_1:N:0:TGGTTT
AGGACGAGATTCGCTAATGCAATGCC
+
CCCFFFFFHHHHHJJJJJJJJJIHIJ
@HWI-ST132:549:C0FYUACXX:5:1101:3864:1924_1:N:0:TGGTTT
TGCTTGGACTACATATGGTTGAGGGTTGTA
+
CCCFFFFFHHHHHJIJJJHIIJJJJIJJJJ
@HWI-ST132:549:C0FYUACXX:5:1101:3786:1958_1:N:0:TGGTTT
TGGAAAATAAAACCTTCTCGAAGGG
+
@C@FFFFFHHFHHJJJJJJJJJJII
@HWI-ST132:549:C0FYUACXX:5:1101:3793:1988_1:N:0:TGGTTT
GAATTCGTAGAAGGAAGATTTTTCGCGGT
+
=@@?DDDEHHHFBGGGGGHIIJIDGEFE?
@HWI-ST132:549:C0FYUACXX:5:1101:4123:1921_1:N:0:TGGTTT
GCATGGATTCCAGAGCAGACTCGGC
+
CCCFFFFFHHHHHIJJJJJJJJCGG
@HWI-ST132:549:C0FYUACXX:5:1101:4030:1974_1:N:0:TGGTTT
GAAGATATTAATTCGCGAGTCTTA
+
CCCFFFFFHHHHHJJJJJJGHIII
@HWI-ST132:549:C0FYUACXX:5:1101:4468:1880_1:N:0:TGGTTT
ATGATGATAGAGACGGCTTGGTAA
+
1=DFFFFHHHHHGIJJJJJJJCGH



Les parametres

Input Parameter         Value   Note for rerun
Single or Paired-end reads      single  
Select reads    11: FASTQ Groomer on data 10    
Filter out chimeric clusters    false   
Length of prefix to be used in the analysis     0       
Match length    True    
Maximum number/percent of mismatches allowed    None    
Description length      0       

Les erreurs:
Fatal error: Exit code 134 ()
cd-hit-dup: cdhit-dup.cxx:159: int HashingDepth(int, int): Assertion `len >= 
min' failed.
Aborted
 From input: /data/galaxy.prabi.fr/database/files/025/dataset_25721.dat
Total number of sequences: 39
Longest: 30
Shortest: 22
Sorted by length ...
Start clustering duplicated sequences ...
primer = 0

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/

Reply via email to