Hi all,

I will appreciate your help in understanding the 'id' key returned from the
API. I am using Galaxy Version 15.03 & bioblend Version 0.8.0.

Example:

I have highlighted the id and related fields with bold and red.

>>> workflowClient.get_invocations('f7bb1edd6b95db62')
> [{u'inputs': {u'1': {u'src': u'hda', u'id': u'06d9fe130fbe098e'}},
> u'update_time': u'2017-05-17T03:09:10', u'uuid':
> u'fd066a98-3aad-11e7-90e9-1cc1de6d5ef4', u'history_id':
> u'b8a0d6158b9961df', u'state': u'scheduled', *u'workflow_id':
> u'915ae9a80309f157'*, u'steps':
> ...
>  u'model_class': u'WorkflowInvocation', *u'id': u'8c49be448cfe29bc'*}]


Why is the '*workflow_id*' different from the one I passed to the fucntion?
And why is that '*workflow_id' *is not found anywhere in the return value?

>>> historyClient.show_dataset(hid,'468b2dfe96a5a9a1')
> {u'accessible': True, u'resubmitted': False, u'create_time':
> u'2017-05-17T03:04:02', u'download_url':
> u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1/display',
> u'file_size': 545, *u'dataset_id': u'56c890cbef28295c', u'id':
> u'468b2dfe96a5a9a1'*, u'misc_info': u'uploaded fastqsanger file',
> u'hda_ldda': u'hda', u'metadata_sequences': 5, u'state': u'ok',
> u'display_types': [], u'display_apps': [], u'type': u'file', u'file_path':
> None, u'misc_blurb': u'5 sequences', u'peek': u'<table cellspacing="0"
> cellpadding="3"><tr><td>@1</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr><tr><td>+</td></tr><tr><td>IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII</td></tr><tr><td>@2</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr></table>',
> u'update_time': u'2017-05-17T03:04:06', u'data_type':
> u'galaxy.datatypes.sequence.FastqSanger', u'tags': [], u'deleted': False,
> u'history_id': u'b8a0d6158b9961df', u'meta_files': [], u'genome_build':
> u'?', u'hid': 1, u'model_class': u'HistoryDatasetAssociation',
> u'metadata_data_lines': 20, u'file_ext': u'fastqsanger', u'annotation':
> None, u'metadata_dbkey': u'?', u'history_content_type': u'dataset', *u'name':
> u'a_1.fastq'*, u'extension': u'fastqsanger', u'visible': True, u'url':
> u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1', u'uuid':
> u'aa6dcf49-6fe9-49e0-8064-c8bc275a37d5', u'visualizations': [], u'purged':
> False, u'api_type': u'file'}
>


>>> historyClient.show_dataset(hid,'56c890cbef28295c')
> {u'accessible': True, u'resubmitted': False, u'create_time':
> u'2017-05-17T02:59:27', u'file_size': 64, *u'dataset_id':
> u'9ccf9e6f1cf4d1fa', u'id': u'56c890cbef28295c'*, u'misc_info':
> u'##fileformat=VCFv4.1\n##FILTER=<ID=PASS,Description="All filters
> passed">\n##fileDate=20170517\n##source=freeBayes
> v0.9.20\n##reference=localref.fa\n##phasing=none\n##commandline="freebayes
> --bam localbam_0.bam --fasta-reference localref.fa --vcf /home/sphadmi',
> u'hda_ldda': u'hda', u'download_url':
> u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c/display',
> u'state': u'ok', u'display_types': [], u'display_apps': [], u'type':
> u'file', u'file_path': None, u'misc_blurb': u'0 lines', u'peek': u'<table
> cellspacing="0" cellpadding="3"><tr><td>#Calculation and writing of high
> density regions has completed.</td></tr></table>', u'update_time':
> u'2017-05-17T02:59:36', u'data_type': u'galaxy.datatypes.data.Text',
> u'tags': [], u'deleted': False, u'history_id': u'06ec17aefa2d49dd',
> u'meta_files': [], u'genome_build': u'?', u'hid': 44, u'model_class':
> u'HistoryDatasetAssociation', u'metadata_data_lines': None, u'file_ext':
> u'txt', u'annotation': None, u'metadata_dbkey': u'?',
> u'history_content_type': u'dataset', *u'name': u'High density regions',*
> u'extension': u'txt', u'visible': False, u'url':
> u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c', u'uuid':
> u'8b8c70a4-cd2e-43d3-bc77-b06511557c96', u'visualizations': [], u'purged':
> False, u'api_type': u'file'}


Similarly, here the '*dataset_id' *is different from the one I passed to
*show_dataset* method. If I check the '*dataset_id*' from first call, it
points to another different file!

Please let me know which of these 'id' should be used and what would be the
purpose of the other id?

Thanks for your help and time!

Best,
Aarthi
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/

Reply via email to