Hello,

My account login is: johnso...@ninds.nih.gov<mailto:johnso...@ninds.nih.gov>

I am a first time Galaxy user.

I have uploaded my sequences as format "fastq" into Galaxy and would like to 
next use "Groomer" to output Sanger fastq format so to go on with exploring 
quality via box plot, deciding on a trim length (if any), and map to genome 
using bwa or bowtie.

However, I am running into a problem using "Groomer".

I do not know what format my sequences are per setting the required input 
parameter.

An example of my sequences is as follows:

@SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX
NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
+SNPSTER6_0679:1:1:1083:939#0/1
BIQQIQQQTP[[[[[VVVVQPPPPPTWWWW[[YYTTTOVV____TWVXRWPTQPQWWWWWTOOVV___V_TROOWTWTWTQWQWTTRWRO

... how to tell if you have: "Sanger", "Solexa", "Illumina 1.3+", etc.

I have tried to submit to "Groomer" different times using these options one at 
a time and none return with results.

Need help please.

Also, what is the expected time for "Groomer" to return results for a file 
containing 2.7 million reads.

Thank you ... best,

Kory

--------------------------------------------

Kory R. Johnson, MS, PhD
Sr. Bioinformatics Scientist

[cid:image001.jpg@01CBC2E0.B2CEC7F0]

www.kellygovernmentsolutions.com

Providing Contract Services For:

Bioinformatics Section,
Information Technology & Bioinformatics Program,
Division of Intramural Research (DIR),
National Institute of Neurological Disorders & Stroke (NINDS),
National Institutes of Health (NIH),
Bethesda, Maryland

Mailing Address:

NINDS/NIH
Clinical Center (Building 10)
Office 5S223
9000 Rockville Pike
Bethesda, MD 20892

Contact Information:

Phone:    301-402-1956
Fax:           301-480-3563
email:       johnso...@ninds.nih.gov

P Green Message:

Please consider the environment before printing this e-mail.  Thank you.

Important Message:

This electronic message transmission contains information intended for the 
recipient only.  Such that, the information contained herein may be 
confidential, privaledged, or proprietary.  If you are not the intended 
recipient, be aware that any disclosure, copying, distribution, or use of this 
information is strictly prohibited.  If you have received this electronic 
information in error, please notify the sender immediately by telephone.  Thank 
you.

--------------------------------------------

<<inline: image001.jpg>>

_______________________________________________
galaxy-user mailing list
galaxy-user@lists.bx.psu.edu
http://lists.bx.psu.edu/listinfo/galaxy-user

Reply via email to