Hello Falak,

In the screencast, the data for the TAF1- binding sites is from the ENCODE pilot project. You can find many TAF1 datasets (ChIP-chip and ChIP-seq) at the ENCODE DCC:

  http://genome.ucsc.edu/ENCODE

Is it that you want to use your own data (after it is mapped) and compare to known genes/regions, as in the TAF1 tutorial? If so, example 3 in this tutorial can help you understand the NGS tools:
http://main.g2.bx.psu.edu/u/aun1/p/ngs-analysis-service

Peter's help (separate email) about the file conversion would be a good choice. (thanks again Peter!)

Best,

Jen
Galaxy team


On 3/28/11 7:11 AM, Sher, Falak wrote:
Hello collegues,
I have two questions which I could not get answered.
I have Illumina single end sequences files, and want to use  them for ChIP-Seq 
analysis.
My first question is:
In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell 
how he has generated the txt. format of the file used for demonstration of 
ChIP-Seq analysis.
I would like to know how I can generate that file from my Illumina sequence 
files to proceed with analysis.
My second question is,
2) How can I convert SAM/BAM formated files (generated by Bowtei mapping tool 
at Galaxy) to Wiggle or Bigwig formats.
I would be thankful for the answers and comments.
Falak


________________________________________
From: galaxy-user-boun...@lists.bx.psu.edu 
[galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Jennifer Jackson 
[j...@bx.psu.edu]
Sent: Monday, March 28, 2011 9:57 AM
To: lishiyong
Cc: galaxy-user
Subject: Re: [galaxy-user] Convert SOLiD data

Hello Lishiyong,

Just to confirm, the conversion was performed at Galaxy main using "NGS:
QC and manipulation ->  Convert SOLiD output to fastq"? With the option
"double encode = yes"? If so, the output appears to be correct.

quote from tool help:

"Double encode? - converts color calls (0123.) to pseudo-nucleotides
(ACGTN). Not necessary for bowtie. Required for BWA."

Please let us know if we can help more,

Best,

Jen
Galaxy team

On 3/27/11 8:35 PM, lishiyong wrote:
Hello!

I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use
the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo
accessory tools Require large memory .But ,I find that there're some
question for the converting .

for example:

T02023221102101032002002030011232121133222233311200 ——>
AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA
But I think it should to be
TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason
about this.
2011-03-28
------------------------------------------------------------------------
lishiyong



___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

    http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

    http://lists.bx.psu.edu/

--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Reply via email to