Apologies for the long content..

I seem to be having a discrepancy with fastx_collapser as well. 
I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa
fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 
26580941 sequences (representing 212647528 reads)    --->  what the..?Output: 
3177400 sequences (representing 212647528 reads)
In my collapsed file, my top read is: >1-35820208TACCTGGTTGATCCTGCCAGTAG
(this is already over my original read count)
When I 
grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566
....
Ok, I've reanalyzed a previous dataset and the output is consistent with my 
previous numbers:
fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 
sequences (representing 36008043 reads)Output: 3886503 sequences (representing 
36008043 reads)
so it doesn't appear to be the toolkit.
How are the tools counting "reads" and "sequences" ?Could the format of the 
headers affect it? hyphens vs underscores? 
This data 
set:>ILLUMINA-08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA
Previous data set:>GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA

Thanks
From: kenec...@hotmail.com
To: galaxy-u...@bx.psu.edu
Date: Thu, 14 Apr 2011 00:54:05 +0000
Subject: [galaxy-user] regarding read counts from fastx_clipper








Hi, 
I'm using the fastx_toolkit (v0.0.13) command line scripts. 
When using fastx_clipper, I get: 
fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o 
s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 
15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 
reads.discarded 3527200 too-short reads.discarded 725608 adapter-only 
reads.discarded 10773384 non-clipped reads.discarded 0 N reads.
The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb.... 
seems like fastx_clipper is reporting way too many reads in this instance.  I 
also tried without the -M option but same thing. 
I checked with:
wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads)
wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads)

There has never been such a discrepancy with this tool. 
I'm not sure if I'm doing something silly this time round, or somethings 
changed in my system that's affecting fastx_clipper counting. 
Heres a couple of lines from input and output:
head -n 6 
s_8_sequence.fa>ILLUMINA-08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA>ILLUMINA-08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGC>ILLUMINA-08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG
head -n 6 
s_8_sequence_clipped.fa>ILLUMINA-08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTT>ILLUMINA-08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAG>ILLUMINA-08A740_0000:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGCCCCGTCAGTCCCGCCA

Any ideas? 
Thanks, 
Ken                                       

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/                                        
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to