Hi All,

In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter 
custom sequence" under "Source", and I can only enter One custom clipping 
sequence. So how can I enter another 3 adapter sequences which I want to clip. 

In addition, In "What it does" it shows: This tool clips adapters from the 
3'-end of the sequences in a FASTA/FASTQ file.

So how could i do if  I have the adapter sequences like this:                   
       
5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT
5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
5' GACGGCATACGAGCTCTTCCGATCT
5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much  for any response!

Best wishes,
Bin
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to