Dear Galaxy Team and users,

I have some 454 reads that I would like to map against a contig assembly using 
LASTZ.  I have already mapped the reads uploaded in fasta format against the 
assembly but, as mapping the reads in fasta ignores the base qualities that 
would be present in a fastq file, I am concerned that I might need the base 
quality information that may be crucial in deciding on 'real' SNPs later down 
the line.  So, as LASTZ apparently recognises fastq (*see below), I converted 
the reads to fastq using the 'Combine fasta and qual' tool in Galaxy and I am 
now currently trying to map the reads to the assembly.  However, Galaxy would 
not recognise the fastq reads in the LASTZ input page.  So I tried to fool it 
by changing the data type of the fastq to fasta using the 'Edit attributes' 
function of the history.  This kept the fastq info but allowed Galaxy to 
recognise the file as input for LASTZ.   However, this mapping has been running 
for almost 24 hours now and so I am concerned that there is an error.

Is anyone able offer any help with why Galaxy does not recognise the reads in 
fastq format prior to mapping with LASTZ?

Here are what the first two reads look like in fastq format:
@GIQ547K01A7QJK length=76 xy=0381_0142 region=1 run=R_2010_06_11_16_16_09_
GCTTCGTGTGCGACGACACTCGTCATCGACAACGCAAGACTGGCGCTATCGCAATTGGACACACAACATGTGACCG
+
27 19 17 17 18 19 11 14 14 17 19 17 22 17 17 14 14 14 17 19 17 19 17 17 19 19 
25 25 22 17 12 13 14 19 21 21 21 27 21 19 19 17 17 19 17 24 25 22 20 22 22 17 
16 16 12 12 12 12 19 22 17 17 17 20 20 22 27 21 25 22 20 20 22 21 16 12
@GIQ547K01AE4BG length=40 xy=0055_0266 region=1 run=R_2010_06_11_16_16_09_
GTGACTAGATACATGCAATCAATTGTCCATGTCATTCGAG
+
27 23 23 19 19 19 18 19 21 19 18 19 18 25 27 27 26 26 27 27 27 27 27 19 19 18 
19 19 27 27 25 24 25 25 21 21 22 22 22 18


* Input formats (copied from the LASTZ input page in Galaxy)
LASTZ accepts reference and reads in FASTA format. However, because Galaxy 
supports implicit format conversion the tool will recognize fastq and other 
method specific formats.

With thanks,
Chris

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to