Hello Hemant,

IDs such as this (resulting from the CASAVA 1.8+ pipeline) work with most tools. For a few others, there is an open ticket at bitbucket to track the progress:
https://bitbucket.org/galaxy/galaxy-central/issue/677/update-joiner-tool-to-work-with-casava-18

However, a problem with Bowtie is not a known issue, except if you consider that it will produce a SAM in the format as you show. But, this is not really a Bowtie problem, it is just passing the FASTQ IDs given as input. Perhaps if I explain the data it will help?

When Bowtie doesn't have a hit to report, it will write out the entire sequence name into the SAM file. When there is a hit to report, the sequence will be in short format, but if you go back into your original FASTQ input and look for that shorter sequence ID, you will find the full name there, including space and additional content (it just wasn't passed into the SAM file).

For downstream 3rd party tools that have problems with the inserted space in the identifier column (MACS is a good example), converting the SAM file to BAM, then using the BAM as input has been a successful work-around.

Hopefully this helps!

Jen
Galaxy team

On 5/30/12 6:58 AM, Kelkar, Hemant wrote:
It is possible that this question has been asked/answered before. I tried 
searching through the galaxy-user list archives on nabble but could not find an 
applicable answer.

-----------------------
Bowtie alignments done using a de-multiplexed Illumina sequence data set (CASAVA v.1.8.2)  
appear to be leading to alignment problem in our local galaxy install. At first glance this 
appears to be because of the " @SOMETHING<space>READINFO" read names not being 
handled correctly by bowtie. This is not a galaxy issue per se but what are other users doing 
to avoid this problem. We are using bowtie v. 0.12.7 (going to upgrade soon) at the moment.

Posting a snippet from the alignment file below:

MACHINE_NAME:2:1101:1533:1944 1:N:0:CGATGT      4       *       0       0       
*       *       0       0       
NACGAAACGGGTCGGTCCGTCGGCATAGCGCGCCACGGCCTGCGGATCGG      
#4=DDFFFHHHFHIJHIJIHIIJJJIIIIIJJIHHFFDDDDDDDDDDDDD      XM:i:0
MACHINE_NAME:2:1101:2523:1962   16      chr5    80936209        255     50M     
*       0       0       CTAAAAGGAAAAATTCCAGGGATTAAGGAACTTGAAGTTAGAAAAACTAN      
IIJJJIHHJJJIHFEIHIJIIJIJJJJIIJIIGJJIJFGHHHFEDAD=4#      XA:i:1  MD:Z:49C0       
NM:i:1
MACHINE_NAME:2:1101:1596:1971   16      chr13   41692461        255     50M     
*       0       0       GCTGAATAATAGTCCATTGTGAACATATACCATGTTTTCTTTATTTTTAN      
JJJJJJJJJIJJIJJJJJJJJJJJJJJHFJJJJJJJJHHHHHFFFFD=4#      XA:i:1  MD:Z:49T0       
NM:i:1
MACHINE_NAME:2:1101:2670:1962 1:N:0:CGATGT      4       *       0       0       
*       *       0       0       
NTGCACTCGCCTGGATACCGTCGCCGGTGAGGTGGCATTCGAACACACCC      

--Hemant



___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

--
Jennifer Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Reply via email to