Hi Galaxy,
Ive got 2 problems for you;
1) Ive got microRNA Illumina NGS data that I want to analyse, I put it through
fastQC on galaxy and it showed that 71% of the reads in one overrepresented
sequence;
Sequence
Count
Percentage Possible Source
GAATTCCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG 16896622
71.06413061961005 RNA PCR Primer, Index 1 (100% over 29bp)
CCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTGTAATCTC 525614
2.2106372475809497 RNA PCR Primer, Index 12 (100% over 44bp)
CCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC 416041
1.7497930632000402 RNA PCR Primer, Index 2 (100% over 34bp)
What would be the best way to remove this contamination? Also is is still ok to
use that data despite such high contamination? Ive currently been trying to
remove the sequence by using the clip adaptor tool, using the following options;
library to clip 2: FASTQ Groomer on data H1
Minimum sequence length (after clipping, sequences shorter than this length
will be discarded) 15
Enter custom clipping sequence
GAATTCCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG
enter non-zero value to keep the adapter sequence and x bases that follow it 0
Discard sequences with unknown (N) bases No
Output options Output only non-clipped sequences (i.e. sequences which did not
contained the adapter)
Clipped reads - discarded.
Input: 23776583 reads.
Output: 3091831 reads.
discarded 1287140 too-short reads.
discarded 18984774 adapter-only reads.
discarded 412838 clipp
but then I'm only left with 13% of the reads.
2) After I've filtered and clipped the adapter I want to analyse the frequency
of each miR. I've been using miranalyzer to do this, I use the following
workflow
data=>groomer=>clip adapter=>filter FastQ (min quality 20)=>fastq to
fasta=>collapse
the collapse file is like this;
>1-17285268
GAATTCCACCACGTTCCCGTGG
>2-522760
CCACCACGTTCCCGTGG
>3-101198
TATTGCACTTGTCCCGGCCTGT
>4-88745
Then upload the collapse file to miranalyzer however the total reads in the
miranalyzer output is the same as the total number of sequences in the collapse
file, it doesn't seem to recognise the count number.
miranalyzer says the following;
2.1 Input formats
miRanalyzer requires a single file containing the unique reads and
their counts. The application accepts two different input formats:
2.1.1 A tab or space separated file as in the following example
(read-count format):
GAGGTAGTAGGTTGTA 49862
ACCCGTAGAACCGACC 15490
... ...
GGAGCATCTCTCGGTC 13762
2.1.2 A multifasta file:
>ID1 49862
GAGGTAGTAGGTTGTA
>ID2 15490
ACCCGTAGAACCGACC
....
>ID 13762
GGAGCATCTCTCGGTC
The description field must hold the read count. If not set, it is
supposed to be 1. The file must have extension ’fa’, ’fasta’ or ’mfa’.
Do you know how I could change my format so it can recognise the read count
e.g. maybe change the '-' to a space?
3) Ive recently got the local install of galaxy but encounter the following
error when I try to add a file to my data libary
Error attempting to display contents of library (New data library):
(OperationalError) no such column: True u'SELECT dataset_permissions.id AS
dataset_permissions_id, dataset_permissions.create_time AS
dataset_permissions_create_time, dataset_permissions.update_time AS
dataset_permissions_update_time, dataset_permissions.action AS
dataset_permissions_action, dataset_permissions.dataset_id AS
dataset_permissions_dataset_id, dataset_permissions.role_id AS
dataset_permissions_role_id XnFROM dataset_permissions XnWHERE True AND
dataset_permissions.action = ?' ['access'].
Ive got the latest version of galaxy and am using chrome and mountain lion os x
changeset: 7986:12fcd068b12e
tag: tip
user: Daniel Blankenberg <d...@bx.psu.edu>
date: Thu Oct 18 11:22:12 2012 -0400
summary: Do not hide failed datasets with HideDatasetAction post job action.
Any help will be greatly appreciated
Thank you
Rosie Griffiths
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
