I have lllumina sequences which are barcoded in the sequence identifier  e.g.:

@FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1
CTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGAAAAATTGTTTTGTGACCTCTCTC

The '#TCGCAGGA" is the barcode. As the barcode is not on the 5'  or 3' end I 
cannot use the barcode splitter. Is there a workaround in Galaxy for this?
Thanks!
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to