Hello,
I would like to use Galaxy to divide a very large Ilumnia fasta file
(~3GB) into separate fasta files. Is this possible on Galaxy? Here is an
example of the reads:
HWI-ST156:535:C10GLACXX:8:1101:1195:1080 1:N:0:CGGTTGT
AAATAGAATATCACATTAAAATCACAAGCAGGACAGTGTGTGTAAAAGAAATCTTTTGTGAATTCAACGTTTATCAATTAGANNNNACGCCTACGTGTAG
HWI-ST156:535:C10GLACXX:8:1101:1210:1102 1:N:0:CGGTTGT
ATTTATCATAACAACTTAAATCAGTCAGTGGATTTCTGTCGGTCCGGTTAGCTCGGTTGGTAAAGGCGTTTGTTCGATCGTCTGTATTTTGCAATCGGGC
I have tried the "Filter and Sort" option to try and select sequences
just by a beginning sequence (ATGC, for example) to separate these
sequences into a specific file, but I have been unsuccessful in this.
Thank you,
Dominique
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/