the file looks good to me (illumina 1.8 because of the ?). I might have 
misunderstood the error message.
If it comes from galaxy when you try to use this file, then you have not
specified the correct file format to galaxy.
You have to change its type to fastqsanger by clicking on the pencil.

HTH,
ido

On Aug 27, 2013, at 5:05 PM, "Law, Michael J." <[email protected]> wrote:

> Of course....Here is an example:
> @HWI-ST1160:394:C1J65ACXX:7:1101:1520:2235 1:N:0:TTAGGC
> CTGACATAGTCTGGTGCGGCAACAATCATTCTTGCCATGAGCCCACCTAG
> +
> @CCDFFFDHDHHGIFHIIJJJJJIGIJ9FIHIBHIIECE@EGGJGHJJBH
> @HWI-ST1160:394:C1J65ACXX:7:1101:1946:2192 1:N:0:TTAGGC
> GCGGATATTGGTACAATAGGAGCACCGTCAGCAATGGTACCTCTGATGAA
> +
> @CCFDDFFHHHHHJIJJJJJHIJGJJJJJGIJIJJJJ?DGGIJJJGIIIJ
> @HWI-ST1160:394:C1J65ACXX:7:1101:1851:2248 1:N:0:TTAGGC
> CTTTGAGTGAACCTCGTCCGGTACTGCTTTTTATTGCCATGTATTATGTG
> +
> @CCFDEFDFHHGHJJJHJJJJCGHIJJJIJJI@FIJJJHIJIIIIDGGFF
> @HWI-ST1160:394:C1J65ACXX:7:1101:2249:2219 1:N:0:TTAGGC
> TCCTCAACCAGTCTTCCTTTTCATCATTTGACTCCAGTGCAGTGAAATCG
> +
> CCCFFFFFGHHFHJJJJJJJJJIJIIIJIEHHGIIFHHIIIJHGIJJIJJ
> Also, whenever I send an email, it says I am not a member, but I have a login 
> (clearly since I have used ftp for data upload). How do I fix this?
> Thanks so much,
> Mike
> 
> Michael Law
> [email protected]
> 
> 
> 
> On Aug 27, 2013, at 4:44 AM, Ido Tamir wrote:
> 
>> You should add 10 lines from one of your files.
>> Then its easier to understand the problem.
>> 
>> best,
>> ido
>> 
>> 
>> On Aug 26, 2013, at 5:17 PM, "Law, Michael J." <[email protected]> wrote:
>> 
>>> Hello,
>>> I am completely new to using galaxy. I have a quick question. I have 
>>> uploaded my fastq files generated from my experiment for alignments using 
>>> bowtie. I try to set up the alignment, only to receive the error message 
>>> that I don't have any sequences with ASCII encoded quality scores. However, 
>>> when I contact my sequencing facility, they say that the scores are present 
>>> in the files and that it may be an issue with galaxy.
>>> Any help you can provide would be appreciated!
>>> Thanks,
>>> Mike
>>> 
>>> 
>>> Michael Law
>>> [email protected]
>>> 
>>> 
>>> 
>>> ___________________________________________________________
>>> The Galaxy User list should be used for the discussion of
>>> Galaxy analysis and other features on the public server
>>> at usegalaxy.org.  Please keep all replies on the list by
>>> using "reply all" in your mail client.  For discussion of
>>> local Galaxy instances and the Galaxy source code, please
>>> use the Galaxy Development list:
>>> 
>>> http://lists.bx.psu.edu/listinfo/galaxy-dev
>>> 
>>> To manage your subscriptions to this and other Galaxy lists,
>>> please use the interface at:
>>> 
>>> http://lists.bx.psu.edu/
>>> 
>>> To search Galaxy mailing lists use the unified search at:
>>> 
>>> http://galaxyproject.org/search/mailinglists/
>> 
> 
> 


___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Reply via email to