Hi Piyu,
Sorry to hear that you are having problems. The barcode splitter tools
requires two inputs and each must be labeled correctly when using the
tool in the UI (datatype assignment - using pencil icon or at upload).
Binaray/compressed files are not permitted in the Galaxy UI (or when
using the Galaxy wrapped tool command-line) as input. If you need to
uncompress your data, Galaxy will do this upon upload for most types,
but on the command-line you'll need to use the extension as a clue then
find/use the appropriate command (should be easy to find online).
Test out in UI a sample, then run line command if you want. These are
the requirements:
*Barcode file* - text tabular delimited file that looks like this and
has a datatype assignment of "tabular".
#mybarcodes
codeA TCATAGACGAAGACGGACTAG
codeB CTAGCAGCAGTCAGCATCAGA
codeC ATCTCGCATACGCAGGCATCG
*FASTQ/A input file* - fastq file with a datatype assignment of ".fastq"
or a variation such as ".fastqsanger". Also accepts ".fasta".
This help section and the next can help more:
http://wiki.galaxyproject.org/Support#Tool_doesn.27t_recognize_dataset
Best,
Jen
Galaxy team
On 8/29/13 1:23 PM, Priyanka Vengurlekar wrote:
Hi all,
I need some serious help i got output from the Miseq machine in fastq file
format. My supevisor asked me to separate barcodes, so since monday i have been
struggling to use this in command- line and executed it but either there is
some mistake that it doesnt recognize any barcodes at all and does not give me
out text file just puts it all in one file called unmatched.I then just to try
tried the convert the fastq to fasta command and it said cannot execute the
binary file....i broke my head so i tried other commands all said cannot
execute binary file...
Q1..so first kindly tell me why any of these binary files cant be executed
from the root directory? and what extra software do i have to download more
then what was within the installation instructions.
So i turned to the galaxy web based usage which was all the more harder i could
not figure out in the barcode splitter program what the library to split
actually require at first i thought the document with barcodes so i uploaded
but this thing just does not show anything in the pulldown for library to
split. Its thursday and i have to still trim the fastq sequences and nothing
seems to work at all with what i am working ....can some body please help
me......
Sincerely,
Piyu
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
